Incidental Mutation 'R1584:Olfr1029'
ID 177307
Institutional Source Beutler Lab
Gene Symbol Olfr1029
Ensembl Gene ENSMUSG00000059873
Gene Name olfactory receptor 1029
Synonyms GA_x6K02T2Q125-47454152-47455126, MOR198-1P
MMRRC Submission 039621-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R1584 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 85973895-85978913 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85975995 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 251 (F251I)
Ref Sequence ENSEMBL: ENSMUSP00000150637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056849] [ENSMUST00000082191] [ENSMUST00000217244]
AlphaFold A2ATE0
Predicted Effect probably benign
Transcript: ENSMUST00000056849
SMART Domains Protein: ENSMUSP00000053309
Gene: ENSMUSG00000044923

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 2.4e-58 PFAM
Pfam:7tm_1 47 296 3.2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000082191
AA Change: F251I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080828
Gene: ENSMUSG00000059873
AA Change: F251I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-56 PFAM
Pfam:7tm_1 41 290 2.1e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217244
AA Change: F251I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1945 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency 99% (106/107)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,515,410 A71V probably damaging Het
Ager A G 17: 34,600,718 E357G probably damaging Het
Akap13 T C 7: 75,729,049 S2095P possibly damaging Het
Ampd2 T C 3: 108,080,337 probably null Het
Arrdc1 T C 2: 24,925,795 I398V probably benign Het
Ash1l T C 3: 89,052,065 Y2250H probably damaging Het
BC005561 T A 5: 104,518,257 I215N probably damaging Het
Brca2 G A 5: 150,552,258 A2478T probably damaging Het
Btrc T A 19: 45,513,382 probably benign Het
C8g C T 2: 25,500,216 A6T probably benign Het
Cdc123 T A 2: 5,803,977 probably null Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Cldn5 G A 16: 18,777,477 G161D probably damaging Het
Cndp2 G A 18: 84,677,315 probably benign Het
Cntnap1 C A 11: 101,180,360 F366L probably damaging Het
Corin C T 5: 72,302,790 probably null Het
Ctdspl2 G A 2: 122,003,929 R332K probably benign Het
Dido1 G A 2: 180,662,328 P1261L probably damaging Het
Dopey1 A T 9: 86,548,172 R2200* probably null Het
Dtx3l G A 16: 35,932,728 L503F probably damaging Het
Dysf A G 6: 84,067,047 K259R probably benign Het
Enpep T A 3: 129,319,448 T203S probably damaging Het
Epha2 T A 4: 141,322,047 probably null Het
Fam20b T C 1: 156,686,188 probably benign Het
Fbln7 A G 2: 128,877,429 T49A probably benign Het
Fgf14 T A 14: 124,676,539 K60M probably benign Het
Fhad1 T C 4: 141,985,511 I206V probably benign Het
Figla A G 6: 86,020,782 E164G probably benign Het
Gimap4 C A 6: 48,691,282 Q196K probably benign Het
Glcci1 C T 6: 8,537,964 T6I probably damaging Het
Gm6583 C T 5: 112,354,764 G358D probably benign Het
Grk4 T C 5: 34,694,750 S113P probably benign Het
Hectd3 G A 4: 116,996,566 E220K probably damaging Het
Hecw1 A G 13: 14,340,743 probably null Het
Helz2 G A 2: 181,236,297 P903S probably damaging Het
Hydin T C 8: 110,580,815 V3942A probably benign Het
Irs1 G T 1: 82,289,444 H350Q probably benign Het
Kdm1b G A 13: 47,064,054 E46K probably damaging Het
Klf11 A G 12: 24,655,305 N253D probably damaging Het
Klhl23 T C 2: 69,833,888 I527T probably damaging Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lcn4 G A 2: 26,668,576 P166L probably damaging Het
Letmd1 T A 15: 100,472,542 probably null Het
Lilra6 T A 7: 3,912,662 D358V probably damaging Het
Mmrn2 A G 14: 34,375,685 D24G probably benign Het
Mpp5 A G 12: 78,829,727 I482V probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mrps35 C T 6: 147,055,984 T169M probably damaging Het
Muc4 G A 16: 32,753,595 G1157D probably benign Het
Naga T A 15: 82,334,788 M237L probably null Het
Nfu1 G A 6: 87,020,809 E225K probably damaging Het
Nin A T 12: 70,042,669 L1324Q probably benign Het
Oc90 T A 15: 65,897,720 Y96F probably damaging Het
Olfr1253 C T 2: 89,752,267 C187Y probably damaging Het
Olfr1471 T C 19: 13,445,659 Y216H probably damaging Het
Olfr25 G A 9: 38,330,131 M181I possibly damaging Het
Olfr522 A G 7: 140,162,203 V249A probably damaging Het
Orc4 A T 2: 48,909,494 C324S possibly damaging Het
Pdzrn4 T C 15: 92,770,537 S857P probably benign Het
Plec C T 15: 76,185,908 E1000K possibly damaging Het
Plvap A T 8: 71,508,481 V149D probably benign Het
Pm20d2 A T 4: 33,174,772 N371K probably damaging Het
Ppp2r5d A G 17: 46,684,684 Y480H probably benign Het
Prkd1 A T 12: 50,425,515 V205E probably damaging Het
R3hdm2 A G 10: 127,476,690 I434V probably benign Het
Rel T A 11: 23,745,546 T246S probably damaging Het
Rnf215 T A 11: 4,136,719 V172E probably damaging Het
Scara3 T C 14: 65,921,104 D485G probably damaging Het
Sec16a A T 2: 26,431,157 Y1308N probably damaging Het
Sis A T 3: 72,932,060 D824E possibly damaging Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Srebf1 C T 11: 60,200,702 R999H probably benign Het
St3gal3 A C 4: 118,107,662 M1R probably null Het
Tapbp C T 17: 33,919,940 probably null Het
Tep1 A T 14: 50,866,037 N265K probably damaging Het
Tln2 T A 9: 67,296,414 N470I probably damaging Het
Trim43a G T 9: 88,588,158 W339L probably damaging Het
Ttc22 T C 4: 106,622,780 F77S probably damaging Het
Ttc8 A G 12: 98,920,764 E32G probably benign Het
Uhmk1 A T 1: 170,208,653 probably null Het
Usp17lc A G 7: 103,418,941 H481R possibly damaging Het
Vamp8 G A 6: 72,385,634 T35M probably damaging Het
Vill A G 9: 119,065,586 Y53C probably damaging Het
Vmn1r222 A T 13: 23,232,762 S94T probably damaging Het
Vmn2r93 A G 17: 18,305,151 Y357C possibly damaging Het
Vps13c T A 9: 67,893,112 V536D possibly damaging Het
Vrtn G A 12: 84,650,081 C535Y probably damaging Het
Vwa3a A G 7: 120,768,165 Y181C probably damaging Het
Wfikkn2 G A 11: 94,238,895 T140I probably damaging Het
Ykt6 T A 11: 5,962,349 F101I probably damaging Het
Zfp277 C T 12: 40,378,826 G174D probably benign Het
Zfp638 A G 6: 83,978,065 probably null Het
Zzef1 C T 11: 72,924,679 P2942S probably damaging Het
Other mutations in Olfr1029
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02020:Olfr1029 APN 2 85975235 utr 5 prime probably benign
IGL02126:Olfr1029 APN 2 85976173 missense probably benign 0.00
IGL02584:Olfr1029 APN 2 85975875 missense probably damaging 0.96
IGL03410:Olfr1029 APN 2 85975420 missense probably damaging 0.99
R1466:Olfr1029 UTSW 2 85975995 missense probably damaging 1.00
R1466:Olfr1029 UTSW 2 85975995 missense probably damaging 1.00
R1499:Olfr1029 UTSW 2 85976028 missense possibly damaging 0.62
R2925:Olfr1029 UTSW 2 85975781 nonsense probably null
R2970:Olfr1029 UTSW 2 85976110 missense possibly damaging 0.75
R4571:Olfr1029 UTSW 2 85975831 missense probably damaging 0.97
R5533:Olfr1029 UTSW 2 85975453 missense possibly damaging 0.78
R5654:Olfr1029 UTSW 2 85976156 missense probably benign 0.00
R5827:Olfr1029 UTSW 2 85975306 missense probably benign 0.00
R5967:Olfr1029 UTSW 2 85976191 missense probably benign 0.01
R6291:Olfr1029 UTSW 2 85975582 missense probably damaging 1.00
R6735:Olfr1029 UTSW 2 85975434 missense possibly damaging 0.81
R6897:Olfr1029 UTSW 2 85975356 missense possibly damaging 0.45
R7053:Olfr1029 UTSW 2 85976014 missense possibly damaging 0.64
R7163:Olfr1029 UTSW 2 85975588 missense probably damaging 1.00
R7358:Olfr1029 UTSW 2 85975436 missense possibly damaging 0.81
R8047:Olfr1029 UTSW 2 85975927 missense possibly damaging 0.52
R8271:Olfr1029 UTSW 2 85975422 missense probably damaging 1.00
R8271:Olfr1029 UTSW 2 85975741 missense probably benign 0.40
R8364:Olfr1029 UTSW 2 85976014 missense possibly damaging 0.64
R9100:Olfr1029 UTSW 2 85975752 missense probably benign 0.00
R9190:Olfr1029 UTSW 2 85975540 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGTGCTGACCCACCACTTATTAAGC -3'
(R):5'- TGGACGCATCAATGCTGTCCTG -3'

Sequencing Primer
(F):5'- GACCCACCACTTATTAAGCTATCTTG -3'
(R):5'- GCATCAATGCTGTCCTGATGAC -3'
Posted On 2014-04-24