Mutagenetix > Incidental Mutations

Incidental Mutation 'R1584:Dido1'

177312

Institutional Source

Beutler Lab

Gene Symbol

Dido1

Ensembl Gene

ENSMUSG00000038914

Gene Name

death inducer-obliterator 1

Synonyms

6720461J16Rik, DIO-1, Datf1, D130048F08Rik

MMRRC Submission

039621-MU

Accession Numbers

Genbank: NM_175551; MGI: 1344352

Is this an essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R1584 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

180657964-180709999 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 180662328 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 1261 (P1261L)

Ref Sequence

ENSEMBL: ENSMUSP00000084794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087517]

AlphaFold

Q8C9B9

Predicted Effect

probably damaging
Transcript: ENSMUST00000087517
AA Change: P1261L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084794
Gene: ENSMUSG00000038914
AA Change: P1261L

Domain	Start	End	E-Value	Type
low complexity region	134	155	N/A	INTRINSIC
PHD	267	317	1.19e-11	SMART
low complexity region	430	446	N/A	INTRINSIC
TFS2M	669	770	1.16e-45	SMART
low complexity region	937	962	N/A	INTRINSIC
low complexity region	1023	1037	N/A	INTRINSIC
Pfam:SPOC	1052	1158	1e-22	PFAM
low complexity region	1253	1267	N/A	INTRINSIC
low complexity region	1279	1308	N/A	INTRINSIC
low complexity region	1372	1391	N/A	INTRINSIC
coiled coil region	1458	1502	N/A	INTRINSIC
low complexity region	1649	1680	N/A	INTRINSIC
low complexity region	1748	1766	N/A	INTRINSIC
low complexity region	1780	1792	N/A	INTRINSIC
low complexity region	1804	1815	N/A	INTRINSIC
internal_repeat_2	1816	1852	3.9e-5	PROSPERO
internal_repeat_1	1819	1859	6.92e-7	PROSPERO
internal_repeat_2	1926	1964	3.9e-5	PROSPERO
internal_repeat_1	1940	1982	6.92e-7	PROSPERO
low complexity region	2025	2045	N/A	INTRINSIC
low complexity region	2123	2160	N/A	INTRINSIC
low complexity region	2163	2177	N/A	INTRINSIC
low complexity region	2182	2239	N/A	INTRINSIC

Meta Mutation Damage Score

0.0822

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.2%

Validation Efficiency

99% (106/107)

MGI Phenotype

FUNCTION: This gene encodes a transcription factor involved in apoptosis. The encoded protein functions in cell cycle progression and plays a role in chromosomal stability. This protein regulates the self-renewal of embryonic stem cells. Disruption of this gene in mice causes symptoms similar to myelodysplastic/myeloproliferative diseases in humans. Mice lacking this gene show severely reduced fertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severely reduced fertility; about one-half develop a transplantable disease characterized by anomalies in spleen, bone marrow, and peripheral blood and including anemia and various symptoms typical of myeloid dysplasia or myeloid proliferation. [provided by MGI curators]

Allele List at MGI

All alleles(245) : Targeted, knock-out(1) Gene trapped(244)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd15	C	T	11: 77,515,410	A71V	probably damaging	Het
Ager	A	G	17: 34,600,718	E357G	probably damaging	Het
Akap13	T	C	7: 75,729,049	S2095P	possibly damaging	Het
Ampd2	T	C	3: 108,080,337		probably null	Het
Arrdc1	T	C	2: 24,925,795	I398V	probably benign	Het
Ash1l	T	C	3: 89,052,065	Y2250H	probably damaging	Het
BC005561	T	A	5: 104,518,257	I215N	probably damaging	Het
Brca2	G	A	5: 150,552,258	A2478T	probably damaging	Het
Btrc	T	A	19: 45,513,382		probably benign	Het
C8g	C	T	2: 25,500,216	A6T	probably benign	Het
Cdc123	T	A	2: 5,803,977		probably null	Het
Cilp	G	A	9: 65,279,715	G1031S	probably damaging	Het
Cldn5	G	A	16: 18,777,477	G161D	probably damaging	Het
Cndp2	G	A	18: 84,677,315		probably benign	Het
Cntnap1	C	A	11: 101,180,360	F366L	probably damaging	Het
Corin	C	T	5: 72,302,790		probably null	Het
Ctdspl2	G	A	2: 122,003,929	R332K	probably benign	Het
Dopey1	A	T	9: 86,548,172	R2200*	probably null	Het
Dtx3l	G	A	16: 35,932,728	L503F	probably damaging	Het
Dysf	A	G	6: 84,067,047	K259R	probably benign	Het
Enpep	T	A	3: 129,319,448	T203S	probably damaging	Het
Epha2	T	A	4: 141,322,047		probably null	Het
Fam20b	T	C	1: 156,686,188		probably benign	Het
Fbln7	A	G	2: 128,877,429	T49A	probably benign	Het
Fgf14	T	A	14: 124,676,539	K60M	probably benign	Het
Fhad1	T	C	4: 141,985,511	I206V	probably benign	Het
Figla	A	G	6: 86,020,782	E164G	probably benign	Het
Gimap4	C	A	6: 48,691,282	Q196K	probably benign	Het
Glcci1	C	T	6: 8,537,964	T6I	probably damaging	Het
Gm6583	C	T	5: 112,354,764	G358D	probably benign	Het
Grk4	T	C	5: 34,694,750	S113P	probably benign	Het
Hectd3	G	A	4: 116,996,566	E220K	probably damaging	Het
Hecw1	A	G	13: 14,340,743		probably null	Het
Helz2	G	A	2: 181,236,297	P903S	probably damaging	Het
Hydin	T	C	8: 110,580,815	V3942A	probably benign	Het
Irs1	G	T	1: 82,289,444	H350Q	probably benign	Het
Kdm1b	G	A	13: 47,064,054	E46K	probably damaging	Het
Klf11	A	G	12: 24,655,305	N253D	probably damaging	Het
Klhl23	T	C	2: 69,833,888	I527T	probably damaging	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lcn4	G	A	2: 26,668,576	P166L	probably damaging	Het
Letmd1	T	A	15: 100,472,542		probably null	Het
Lilra6	T	A	7: 3,912,662	D358V	probably damaging	Het
Mmrn2	A	G	14: 34,375,685	D24G	probably benign	Het
Mpp5	A	G	12: 78,829,727	I482V	probably benign	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Mrps35	C	T	6: 147,055,984	T169M	probably damaging	Het
Muc4	G	A	16: 32,753,595	G1157D	probably benign	Het
Naga	T	A	15: 82,334,788	M237L	probably null	Het
Nfu1	G	A	6: 87,020,809	E225K	probably damaging	Het
Nin	A	T	12: 70,042,669	L1324Q	probably benign	Het
Oc90	T	A	15: 65,897,720	Y96F	probably damaging	Het
Olfr1029	T	A	2: 85,975,995	F251I	probably damaging	Het
Olfr1253	C	T	2: 89,752,267	C187Y	probably damaging	Het
Olfr1471	T	C	19: 13,445,659	Y216H	probably damaging	Het
Olfr25	G	A	9: 38,330,131	M181I	possibly damaging	Het
Olfr522	A	G	7: 140,162,203	V249A	probably damaging	Het
Orc4	A	T	2: 48,909,494	C324S	possibly damaging	Het
Pdzrn4	T	C	15: 92,770,537	S857P	probably benign	Het
Plec	C	T	15: 76,185,908	E1000K	possibly damaging	Het
Plvap	A	T	8: 71,508,481	V149D	probably benign	Het
Pm20d2	A	T	4: 33,174,772	N371K	probably damaging	Het
Ppp2r5d	A	G	17: 46,684,684	Y480H	probably benign	Het
Prkd1	A	T	12: 50,425,515	V205E	probably damaging	Het
R3hdm2	A	G	10: 127,476,690	I434V	probably benign	Het
Rel	T	A	11: 23,745,546	T246S	probably damaging	Het
Rnf215	T	A	11: 4,136,719	V172E	probably damaging	Het
Scara3	T	C	14: 65,921,104	D485G	probably damaging	Het
Sec16a	A	T	2: 26,431,157	Y1308N	probably damaging	Het
Sis	A	T	3: 72,932,060	D824E	possibly damaging	Het
Slc27a4	T	A	2: 29,811,190	V331E	probably damaging	Het
Srebf1	C	T	11: 60,200,702	R999H	probably benign	Het
St3gal3	A	C	4: 118,107,662	M1R	probably null	Het
Tapbp	C	T	17: 33,919,940		probably null	Het
Tep1	A	T	14: 50,866,037	N265K	probably damaging	Het
Tln2	T	A	9: 67,296,414	N470I	probably damaging	Het
Trim43a	G	T	9: 88,588,158	W339L	probably damaging	Het
Ttc22	T	C	4: 106,622,780	F77S	probably damaging	Het
Ttc8	A	G	12: 98,920,764	E32G	probably benign	Het
Uhmk1	A	T	1: 170,208,653		probably null	Het
Usp17lc	A	G	7: 103,418,941	H481R	possibly damaging	Het
Vamp8	G	A	6: 72,385,634	T35M	probably damaging	Het
Vill	A	G	9: 119,065,586	Y53C	probably damaging	Het
Vmn1r222	A	T	13: 23,232,762	S94T	probably damaging	Het
Vmn2r93	A	G	17: 18,305,151	Y357C	possibly damaging	Het
Vps13c	T	A	9: 67,893,112	V536D	possibly damaging	Het
Vrtn	G	A	12: 84,650,081	C535Y	probably damaging	Het
Vwa3a	A	G	7: 120,768,165	Y181C	probably damaging	Het
Wfikkn2	G	A	11: 94,238,895	T140I	probably damaging	Het
Ykt6	T	A	11: 5,962,349	F101I	probably damaging	Het
Zfp277	C	T	12: 40,378,826	G174D	probably benign	Het
Zfp638	A	G	6: 83,978,065		probably null	Het
Zzef1	C	T	11: 72,924,679	P2942S	probably damaging	Het

Other mutations in Dido1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Dido1	APN	2	180683989	missense	probably benign
IGL00834:Dido1	APN	2	180689526	missense	possibly damaging	0.87
IGL01317:Dido1	APN	2	180671757	missense	probably benign	0.17
IGL01588:Dido1	APN	2	180688875	missense	probably benign	0.00
IGL01834:Dido1	APN	2	180684031	splice site	probably benign
IGL02102:Dido1	APN	2	180662247	missense	possibly damaging	0.58
IGL02556:Dido1	APN	2	180689335	missense	possibly damaging	0.69
IGL02756:Dido1	APN	2	180661923	missense	probably benign	0.00
IGL02826:Dido1	APN	2	180683958	missense	probably benign
IGL02970:Dido1	APN	2	180689415	missense	probably damaging	0.99
IGL03110:Dido1	APN	2	180689342	missense	probably damaging	1.00
IGL03116:Dido1	APN	2	180670979	missense	probably damaging	1.00
3370:Dido1	UTSW	2	180671542	missense	probably benign
A4554:Dido1	UTSW	2	180675371	missense	probably damaging	1.00
H8441:Dido1	UTSW	2	180689014	missense	probably benign	0.12
R0044:Dido1	UTSW	2	180661819	missense	probably damaging	1.00
R0044:Dido1	UTSW	2	180661819	missense	probably damaging	1.00
R0054:Dido1	UTSW	2	180661474	missense	probably benign	0.00
R0054:Dido1	UTSW	2	180661474	missense	probably benign	0.00
R0127:Dido1	UTSW	2	180671824	missense	probably benign	0.01
R0620:Dido1	UTSW	2	180659851	missense	probably benign	0.26
R0734:Dido1	UTSW	2	180660042	missense	probably benign	0.01
R1390:Dido1	UTSW	2	180685124	missense	possibly damaging	0.70
R1445:Dido1	UTSW	2	180671470	missense	possibly damaging	0.62
R1466:Dido1	UTSW	2	180662328	missense	probably damaging	1.00
R1466:Dido1	UTSW	2	180662328	missense	probably damaging	1.00
R1472:Dido1	UTSW	2	180660720	missense	probably benign	0.02
R1538:Dido1	UTSW	2	180684970	missense	possibly damaging	0.49
R2020:Dido1	UTSW	2	180659585	missense	unknown
R2025:Dido1	UTSW	2	180689181	nonsense	probably null
R2026:Dido1	UTSW	2	180689181	nonsense	probably null
R2027:Dido1	UTSW	2	180689181	nonsense	probably null
R2089:Dido1	UTSW	2	180661884	missense	probably benign	0.29
R2091:Dido1	UTSW	2	180661884	missense	probably benign	0.29
R2091:Dido1	UTSW	2	180661884	missense	probably benign	0.29
R2495:Dido1	UTSW	2	180689388	missense	probably benign	0.00
R2931:Dido1	UTSW	2	180661653	missense	probably damaging	1.00
R3418:Dido1	UTSW	2	180660935	missense	possibly damaging	0.84
R3735:Dido1	UTSW	2	180684036	splice site	probably benign
R4523:Dido1	UTSW	2	180672292	missense	probably damaging	1.00
R4674:Dido1	UTSW	2	180687559	missense	probably damaging	0.97
R4729:Dido1	UTSW	2	180687650	missense	probably benign	0.00
R4762:Dido1	UTSW	2	180689575	missense	probably damaging	1.00
R4786:Dido1	UTSW	2	180670871	missense	possibly damaging	0.85
R4817:Dido1	UTSW	2	180661416	missense	probably benign	0.02
R4892:Dido1	UTSW	2	180675029	nonsense	probably null
R4979:Dido1	UTSW	2	180660813	missense	probably damaging	0.98
R5510:Dido1	UTSW	2	180685173	missense	probably benign	0.00
R5586:Dido1	UTSW	2	180659652	nonsense	probably null
R5672:Dido1	UTSW	2	180671903	missense	probably damaging	0.99
R5863:Dido1	UTSW	2	180661773	missense	probably benign	0.02
R5943:Dido1	UTSW	2	180661882	missense	probably benign	0.00
R5974:Dido1	UTSW	2	180671497	missense	probably benign	0.02
R6123:Dido1	UTSW	2	180683967	missense	probably benign	0.07
R6214:Dido1	UTSW	2	180662152	missense	probably damaging	1.00
R6215:Dido1	UTSW	2	180662152	missense	probably damaging	1.00
R6248:Dido1	UTSW	2	180660255	missense	probably damaging	1.00
R6285:Dido1	UTSW	2	180661147	missense	probably benign	0.00
R6349:Dido1	UTSW	2	180660701	missense	probably benign	0.03
R6437:Dido1	UTSW	2	180675013	missense	probably damaging	1.00
R6477:Dido1	UTSW	2	180660481	missense	probably benign	0.00
R6836:Dido1	UTSW	2	180662307	missense	probably benign	0.16
R7055:Dido1	UTSW	2	180661209	missense	probably benign	0.09
R7289:Dido1	UTSW	2	180659631	missense	unknown
R7304:Dido1	UTSW	2	180687493	missense	probably damaging	1.00
R7343:Dido1	UTSW	2	180675121	missense	possibly damaging	0.49
R7363:Dido1	UTSW	2	180662517	nonsense	probably null
R7429:Dido1	UTSW	2	180689526	missense	possibly damaging	0.87
R7594:Dido1	UTSW	2	180675112	missense	probably benign
R7629:Dido1	UTSW	2	180661473	missense	probably benign
R7899:Dido1	UTSW	2	180671597	missense	possibly damaging	0.82
R7946:Dido1	UTSW	2	180661708	missense	possibly damaging	0.81
R7951:Dido1	UTSW	2	180670881	missense	probably benign	0.01
R8033:Dido1	UTSW	2	180674842	missense	probably damaging	1.00
R8069:Dido1	UTSW	2	180660912	missense	probably benign
R8331:Dido1	UTSW	2	180660449	missense	probably benign	0.00
R8479:Dido1	UTSW	2	180673229	critical splice donor site	probably null
R8936:Dido1	UTSW	2	180661402	missense	probably benign
R9089:Dido1	UTSW	2	180661500	missense	probably benign	0.00
V1024:Dido1	UTSW	2	180689014	missense	probably benign	0.12
X0011:Dido1	UTSW	2	180660834	missense	probably benign	0.00
X0019:Dido1	UTSW	2	180671572	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- CCTTGGCCTTGGAATCCTGATGTG -3'
(R):5'- ATGAGAAGCGGACTCGACTCCAAC -3'

Sequencing Primer
(F):5'- TCCAGACGGCTCAAATGATTTC -3'
(R):5'- GGACTCGACTCCAACAGGAAG -3'

Posted On

2014-04-24