Incidental Mutation 'R1584:St3gal3'
ID177321
Institutional Source Beutler Lab
Gene Symbol St3gal3
Ensembl Gene ENSMUSG00000028538
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 3
SynonymsSiat6, Siat3, ST3Gal III
MMRRC Submission 039621-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1584 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location117932154-118134914 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to C at 118107662 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 1 (M1R)
Ref Sequence ENSEMBL: ENSMUSP00000102018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030263] [ENSMUST00000097912] [ENSMUST00000106410]
Predicted Effect probably null
Transcript: ENSMUST00000030263
AA Change: M1R
SMART Domains Protein: ENSMUSP00000030263
Gene: ENSMUSG00000028538
AA Change: M1R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
Pfam:Glyco_transf_29 102 373 5.7e-75 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000097912
AA Change: M1R
SMART Domains Protein: ENSMUSP00000095525
Gene: ENSMUSG00000028538
AA Change: M1R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 86 357 5.4e-75 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106410
AA Change: M1R
SMART Domains Protein: ENSMUSP00000102018
Gene: ENSMUSG00000028538
AA Change: M1R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
Pfam:Glyco_transf_29 106 372 4.7e-63 PFAM
Meta Mutation Damage Score 0.9735 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency 99% (106/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi apparatus but can be proteolytically processed to a soluble form. This protein is a member of glycosyltransferase family 29. Mutations in this gene have been associated with autosomal recessive nonsymdromic mental retardation-12 (MRT12). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene show an apparently normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,515,410 A71V probably damaging Het
Ager A G 17: 34,600,718 E357G probably damaging Het
Akap13 T C 7: 75,729,049 S2095P possibly damaging Het
Ampd2 T C 3: 108,080,337 probably null Het
Arrdc1 T C 2: 24,925,795 I398V probably benign Het
Ash1l T C 3: 89,052,065 Y2250H probably damaging Het
BC005561 T A 5: 104,518,257 I215N probably damaging Het
Brca2 G A 5: 150,552,258 A2478T probably damaging Het
Btrc T A 19: 45,513,382 probably benign Het
C8g C T 2: 25,500,216 A6T probably benign Het
Cdc123 T A 2: 5,803,977 probably null Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Cldn5 G A 16: 18,777,477 G161D probably damaging Het
Cndp2 G A 18: 84,677,315 probably benign Het
Cntnap1 C A 11: 101,180,360 F366L probably damaging Het
Corin C T 5: 72,302,790 probably null Het
Ctdspl2 G A 2: 122,003,929 R332K probably benign Het
Dido1 G A 2: 180,662,328 P1261L probably damaging Het
Dopey1 A T 9: 86,548,172 R2200* probably null Het
Dtx3l G A 16: 35,932,728 L503F probably damaging Het
Dysf A G 6: 84,067,047 K259R probably benign Het
Enpep T A 3: 129,319,448 T203S probably damaging Het
Epha2 T A 4: 141,322,047 probably null Het
Fam20b T C 1: 156,686,188 probably benign Het
Fbln7 A G 2: 128,877,429 T49A probably benign Het
Fgf14 T A 14: 124,676,539 K60M probably benign Het
Fhad1 T C 4: 141,985,511 I206V probably benign Het
Figla A G 6: 86,020,782 E164G probably benign Het
Gimap4 C A 6: 48,691,282 Q196K probably benign Het
Glcci1 C T 6: 8,537,964 T6I probably damaging Het
Gm6583 C T 5: 112,354,764 G358D probably benign Het
Grk4 T C 5: 34,694,750 S113P probably benign Het
Hectd3 G A 4: 116,996,566 E220K probably damaging Het
Hecw1 A G 13: 14,340,743 probably null Het
Helz2 G A 2: 181,236,297 P903S probably damaging Het
Hydin T C 8: 110,580,815 V3942A probably benign Het
Irs1 G T 1: 82,289,444 H350Q probably benign Het
Kdm1b G A 13: 47,064,054 E46K probably damaging Het
Klf11 A G 12: 24,655,305 N253D probably damaging Het
Klhl23 T C 2: 69,833,888 I527T probably damaging Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lcn4 G A 2: 26,668,576 P166L probably damaging Het
Letmd1 T A 15: 100,472,542 probably null Het
Lilra6 T A 7: 3,912,662 D358V probably damaging Het
Mmrn2 A G 14: 34,375,685 D24G probably benign Het
Mpp5 A G 12: 78,829,727 I482V probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mrps35 C T 6: 147,055,984 T169M probably damaging Het
Muc4 G A 16: 32,753,595 G1157D probably benign Het
Naga T A 15: 82,334,788 M237L probably null Het
Nfu1 G A 6: 87,020,809 E225K probably damaging Het
Nin A T 12: 70,042,669 L1324Q probably benign Het
Oc90 T A 15: 65,897,720 Y96F probably damaging Het
Olfr1029 T A 2: 85,975,995 F251I probably damaging Het
Olfr1253 C T 2: 89,752,267 C187Y probably damaging Het
Olfr1471 T C 19: 13,445,659 Y216H probably damaging Het
Olfr25 G A 9: 38,330,131 M181I possibly damaging Het
Olfr522 A G 7: 140,162,203 V249A probably damaging Het
Orc4 A T 2: 48,909,494 C324S possibly damaging Het
Pdzrn4 T C 15: 92,770,537 S857P probably benign Het
Plec C T 15: 76,185,908 E1000K possibly damaging Het
Plvap A T 8: 71,508,481 V149D probably benign Het
Pm20d2 A T 4: 33,174,772 N371K probably damaging Het
Ppp2r5d A G 17: 46,684,684 Y480H probably benign Het
Prkd1 A T 12: 50,425,515 V205E probably damaging Het
R3hdm2 A G 10: 127,476,690 I434V probably benign Het
Rel T A 11: 23,745,546 T246S probably damaging Het
Rnf215 T A 11: 4,136,719 V172E probably damaging Het
Scara3 T C 14: 65,921,104 D485G probably damaging Het
Sec16a A T 2: 26,431,157 Y1308N probably damaging Het
Sis A T 3: 72,932,060 D824E possibly damaging Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Srebf1 C T 11: 60,200,702 R999H probably benign Het
Tapbp C T 17: 33,919,940 probably null Het
Tep1 A T 14: 50,866,037 N265K probably damaging Het
Tln2 T A 9: 67,296,414 N470I probably damaging Het
Trim43a G T 9: 88,588,158 W339L probably damaging Het
Ttc22 T C 4: 106,622,780 F77S probably damaging Het
Ttc8 A G 12: 98,920,764 E32G probably benign Het
Uhmk1 A T 1: 170,208,653 probably null Het
Usp17lc A G 7: 103,418,941 H481R possibly damaging Het
Vamp8 G A 6: 72,385,634 T35M probably damaging Het
Vill A G 9: 119,065,586 Y53C probably damaging Het
Vmn1r222 A T 13: 23,232,762 S94T probably damaging Het
Vmn2r93 A G 17: 18,305,151 Y357C possibly damaging Het
Vps13c T A 9: 67,893,112 V536D possibly damaging Het
Vrtn G A 12: 84,650,081 C535Y probably damaging Het
Vwa3a A G 7: 120,768,165 Y181C probably damaging Het
Wfikkn2 G A 11: 94,238,895 T140I probably damaging Het
Ykt6 T A 11: 5,962,349 F101I probably damaging Het
Zfp277 C T 12: 40,378,826 G174D probably benign Het
Zfp638 A G 6: 83,978,065 probably null Het
Zzef1 C T 11: 72,924,679 P2942S probably damaging Het
Other mutations in St3gal3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:St3gal3 APN 4 118031875 missense probably damaging 1.00
IGL02004:St3gal3 APN 4 117960039 missense possibly damaging 0.90
IGL02339:St3gal3 APN 4 117958562 missense probably damaging 1.00
IGL03186:St3gal3 APN 4 117940054 missense possibly damaging 0.93
giovanni UTSW 4 117960007 missense possibly damaging 0.84
Leporello UTSW 4 117957436 missense
R0598:St3gal3 UTSW 4 118107632 missense probably benign 0.38
R1466:St3gal3 UTSW 4 118107662 start codon destroyed probably null
R1466:St3gal3 UTSW 4 118107662 start codon destroyed probably null
R1474:St3gal3 UTSW 4 118014786 missense probably damaging 1.00
R1585:St3gal3 UTSW 4 117960007 missense possibly damaging 0.84
R1696:St3gal3 UTSW 4 117940392 missense possibly damaging 0.52
R1735:St3gal3 UTSW 4 118014774 missense probably damaging 1.00
R1958:St3gal3 UTSW 4 117940071 missense probably damaging 0.96
R4008:St3gal3 UTSW 4 117940440 missense probably benign 0.34
R4700:St3gal3 UTSW 4 117960035 missense probably benign 0.01
R5434:St3gal3 UTSW 4 117940050 missense probably damaging 1.00
R6257:St3gal3 UTSW 4 118107678 start gained probably benign
R6854:St3gal3 UTSW 4 117958530 missense probably benign 0.00
R7218:St3gal3 UTSW 4 117957442 missense
R7304:St3gal3 UTSW 4 117957436 missense
R7569:St3gal3 UTSW 4 117964356 missense probably benign 0.09
R7783:St3gal3 UTSW 4 117940123 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CAGTCCGAGGTTTGACGTGAAGAG -3'
(R):5'- AATCTGCCGTCCACAGGAACAAGG -3'

Sequencing Primer
(F):5'- AGCGGAGATTTGCCACAG -3'
(R):5'- TCCACAGGAACAAGGAGAGG -3'
Posted On2014-04-24