Incidental Mutation 'R1584:Fhad1'
ID 177323
Institutional Source Beutler Lab
Gene Symbol Fhad1
Ensembl Gene ENSMUSG00000051435
Gene Name forkhead-associated phosphopeptide binding domain 1
Synonyms 2900090M10Rik
MMRRC Submission 039621-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R1584 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 141617749-141742393 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141712822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 206 (I206V)
Ref Sequence ENSEMBL: ENSMUSP00000101406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105779] [ENSMUST00000105780]
AlphaFold A6PWD2
Predicted Effect probably benign
Transcript: ENSMUST00000105779
AA Change: I206V

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101405
Gene: ENSMUSG00000051435
AA Change: I206V

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105780
AA Change: I206V

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101406
Gene: ENSMUSG00000051435
AA Change: I206V

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146094
Meta Mutation Damage Score 0.0593 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency 99% (106/107)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,406,236 (GRCm39) A71V probably damaging Het
Ager A G 17: 34,819,692 (GRCm39) E357G probably damaging Het
Akap13 T C 7: 75,378,797 (GRCm39) S2095P possibly damaging Het
Ampd2 T C 3: 107,987,653 (GRCm39) probably null Het
Arrdc1 T C 2: 24,815,807 (GRCm39) I398V probably benign Het
Ash1l T C 3: 88,959,372 (GRCm39) Y2250H probably damaging Het
Brca2 G A 5: 150,475,723 (GRCm39) A2478T probably damaging Het
Btrc T A 19: 45,501,821 (GRCm39) probably benign Het
C8g C T 2: 25,390,228 (GRCm39) A6T probably benign Het
Ccdc121rt3 C T 5: 112,502,630 (GRCm39) G358D probably benign Het
Cdc123 T A 2: 5,808,788 (GRCm39) probably null Het
Cilp G A 9: 65,186,997 (GRCm39) G1031S probably damaging Het
Cldn5 G A 16: 18,596,227 (GRCm39) G161D probably damaging Het
Cndp2 G A 18: 84,695,440 (GRCm39) probably benign Het
Cntnap1 C A 11: 101,071,186 (GRCm39) F366L probably damaging Het
Corin C T 5: 72,460,133 (GRCm39) probably null Het
Ctdspl2 G A 2: 121,834,410 (GRCm39) R332K probably benign Het
Dido1 G A 2: 180,304,121 (GRCm39) P1261L probably damaging Het
Dop1a A T 9: 86,430,225 (GRCm39) R2200* probably null Het
Dtx3l G A 16: 35,753,098 (GRCm39) L503F probably damaging Het
Dysf A G 6: 84,044,029 (GRCm39) K259R probably benign Het
Enpep T A 3: 129,113,097 (GRCm39) T203S probably damaging Het
Epha2 T A 4: 141,049,358 (GRCm39) probably null Het
Fam20b T C 1: 156,513,758 (GRCm39) probably benign Het
Fbln7 A G 2: 128,719,349 (GRCm39) T49A probably benign Het
Fgf14 T A 14: 124,913,951 (GRCm39) K60M probably benign Het
Figla A G 6: 85,997,764 (GRCm39) E164G probably benign Het
Gimap4 C A 6: 48,668,216 (GRCm39) Q196K probably benign Het
Glcci1 C T 6: 8,537,964 (GRCm39) T6I probably damaging Het
Grk4 T C 5: 34,852,094 (GRCm39) S113P probably benign Het
Hectd3 G A 4: 116,853,763 (GRCm39) E220K probably damaging Het
Hecw1 A G 13: 14,515,328 (GRCm39) probably null Het
Helz2 G A 2: 180,878,090 (GRCm39) P903S probably damaging Het
Hydin T C 8: 111,307,447 (GRCm39) V3942A probably benign Het
Irs1 G T 1: 82,267,165 (GRCm39) H350Q probably benign Het
Kdm1b G A 13: 47,217,530 (GRCm39) E46K probably damaging Het
Klf11 A G 12: 24,705,304 (GRCm39) N253D probably damaging Het
Klhl23 T C 2: 69,664,232 (GRCm39) I527T probably damaging Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lcn4 G A 2: 26,558,588 (GRCm39) P166L probably damaging Het
Letmd1 T A 15: 100,370,423 (GRCm39) probably null Het
Lilra6 T A 7: 3,915,661 (GRCm39) D358V probably damaging Het
Mmrn2 A G 14: 34,097,642 (GRCm39) D24G probably benign Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Mrps35 C T 6: 146,957,482 (GRCm39) T169M probably damaging Het
Muc4 G A 16: 32,574,886 (GRCm39) G1157D probably benign Het
Naga T A 15: 82,218,989 (GRCm39) M237L probably null Het
Nfu1 G A 6: 86,997,791 (GRCm39) E225K probably damaging Het
Nin A T 12: 70,089,443 (GRCm39) L1324Q probably benign Het
Oc90 T A 15: 65,769,569 (GRCm39) Y96F probably damaging Het
Or4a80 C T 2: 89,582,611 (GRCm39) C187Y probably damaging Het
Or5b116 T C 19: 13,423,023 (GRCm39) Y216H probably damaging Het
Or5m11b T A 2: 85,806,339 (GRCm39) F251I probably damaging Het
Or6ae1 A G 7: 139,742,116 (GRCm39) V249A probably damaging Het
Or8c9 G A 9: 38,241,427 (GRCm39) M181I possibly damaging Het
Orc4 A T 2: 48,799,506 (GRCm39) C324S possibly damaging Het
Pals1 A G 12: 78,876,501 (GRCm39) I482V probably benign Het
Pdzrn4 T C 15: 92,668,418 (GRCm39) S857P probably benign Het
Plec C T 15: 76,070,108 (GRCm39) E1000K possibly damaging Het
Plvap A T 8: 71,961,125 (GRCm39) V149D probably benign Het
Pm20d2 A T 4: 33,174,772 (GRCm39) N371K probably damaging Het
Ppp2r5d A G 17: 46,995,610 (GRCm39) Y480H probably benign Het
Prkd1 A T 12: 50,472,298 (GRCm39) V205E probably damaging Het
R3hdm2 A G 10: 127,312,559 (GRCm39) I434V probably benign Het
Rel T A 11: 23,695,546 (GRCm39) T246S probably damaging Het
Rnf215 T A 11: 4,086,719 (GRCm39) V172E probably damaging Het
Scara3 T C 14: 66,158,553 (GRCm39) D485G probably damaging Het
Sec16a A T 2: 26,321,169 (GRCm39) Y1308N probably damaging Het
Sis A T 3: 72,839,393 (GRCm39) D824E possibly damaging Het
Slc27a4 T A 2: 29,701,202 (GRCm39) V331E probably damaging Het
Srebf1 C T 11: 60,091,528 (GRCm39) R999H probably benign Het
St3gal3 A C 4: 117,964,859 (GRCm39) M1R probably null Het
Tapbp C T 17: 34,138,914 (GRCm39) probably null Het
Tep1 A T 14: 51,103,494 (GRCm39) N265K probably damaging Het
Thoc2l T A 5: 104,666,123 (GRCm39) I215N probably damaging Het
Tln2 T A 9: 67,203,696 (GRCm39) N470I probably damaging Het
Trim43a G T 9: 88,470,211 (GRCm39) W339L probably damaging Het
Ttc22 T C 4: 106,479,977 (GRCm39) F77S probably damaging Het
Ttc8 A G 12: 98,887,023 (GRCm39) E32G probably benign Het
Uhmk1 A T 1: 170,036,222 (GRCm39) probably null Het
Usp17lc A G 7: 103,068,148 (GRCm39) H481R possibly damaging Het
Vamp8 G A 6: 72,362,617 (GRCm39) T35M probably damaging Het
Vill A G 9: 118,894,654 (GRCm39) Y53C probably damaging Het
Vmn1r222 A T 13: 23,416,932 (GRCm39) S94T probably damaging Het
Vmn2r93 A G 17: 18,525,413 (GRCm39) Y357C possibly damaging Het
Vps13c T A 9: 67,800,394 (GRCm39) V536D possibly damaging Het
Vrtn G A 12: 84,696,855 (GRCm39) C535Y probably damaging Het
Vwa3a A G 7: 120,367,388 (GRCm39) Y181C probably damaging Het
Wfikkn2 G A 11: 94,129,721 (GRCm39) T140I probably damaging Het
Ykt6 T A 11: 5,912,349 (GRCm39) F101I probably damaging Het
Zfp277 C T 12: 40,428,825 (GRCm39) G174D probably benign Het
Zfp638 A G 6: 83,955,047 (GRCm39) probably null Het
Zzef1 C T 11: 72,815,505 (GRCm39) P2942S probably damaging Het
Other mutations in Fhad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fhad1 APN 4 141,632,923 (GRCm39) missense probably benign 0.02
IGL01478:Fhad1 APN 4 141,678,949 (GRCm39) missense possibly damaging 0.84
IGL01752:Fhad1 APN 4 141,700,210 (GRCm39) missense possibly damaging 0.82
IGL01788:Fhad1 APN 4 141,660,113 (GRCm39) missense probably benign 0.00
IGL01919:Fhad1 APN 4 141,691,906 (GRCm39) missense probably damaging 0.96
IGL02489:Fhad1 APN 4 141,684,931 (GRCm39) missense probably damaging 0.97
IGL02568:Fhad1 APN 4 141,660,105 (GRCm39) missense probably null 1.00
IGL02583:Fhad1 APN 4 141,738,955 (GRCm39) utr 5 prime probably benign
IGL02716:Fhad1 APN 4 141,645,642 (GRCm39) missense possibly damaging 0.89
IGL02819:Fhad1 APN 4 141,646,069 (GRCm39) missense probably benign 0.23
IGL02820:Fhad1 APN 4 141,646,069 (GRCm39) missense probably benign 0.23
IGL03038:Fhad1 APN 4 141,729,805 (GRCm39) missense probably benign 0.38
IGL03167:Fhad1 APN 4 141,700,108 (GRCm39) missense probably benign 0.00
IGL03255:Fhad1 APN 4 141,700,191 (GRCm39) missense possibly damaging 0.79
R4466_Fhad1_343 UTSW 4 141,684,969 (GRCm39) missense probably damaging 1.00
R4831_Fhad1_494 UTSW 4 141,643,378 (GRCm39) splice site probably null
R5504_Fhad1_818 UTSW 4 141,712,846 (GRCm39) missense probably benign
BB002:Fhad1 UTSW 4 141,681,498 (GRCm39) missense probably damaging 0.97
BB012:Fhad1 UTSW 4 141,681,498 (GRCm39) missense probably damaging 0.97
PIT1430001:Fhad1 UTSW 4 141,637,060 (GRCm39) missense probably damaging 0.99
R0014:Fhad1 UTSW 4 141,655,719 (GRCm39) missense probably damaging 1.00
R0116:Fhad1 UTSW 4 141,667,406 (GRCm39) missense probably benign 0.06
R0143:Fhad1 UTSW 4 141,656,957 (GRCm39) splice site probably benign
R0178:Fhad1 UTSW 4 141,682,651 (GRCm39) missense probably benign 0.31
R0308:Fhad1 UTSW 4 141,712,904 (GRCm39) splice site probably benign
R0384:Fhad1 UTSW 4 141,729,737 (GRCm39) missense probably benign
R0583:Fhad1 UTSW 4 141,631,301 (GRCm39) missense probably benign 0.37
R1501:Fhad1 UTSW 4 141,691,936 (GRCm39) missense probably benign
R1615:Fhad1 UTSW 4 141,649,634 (GRCm39) missense probably damaging 0.99
R1991:Fhad1 UTSW 4 141,709,473 (GRCm39) missense possibly damaging 0.75
R2060:Fhad1 UTSW 4 141,626,560 (GRCm39) missense probably benign 0.08
R2079:Fhad1 UTSW 4 141,718,513 (GRCm39) nonsense probably null
R2133:Fhad1 UTSW 4 141,655,711 (GRCm39) missense probably damaging 1.00
R2337:Fhad1 UTSW 4 141,649,655 (GRCm39) missense possibly damaging 0.84
R2843:Fhad1 UTSW 4 141,632,279 (GRCm39) missense probably benign 0.06
R2844:Fhad1 UTSW 4 141,632,279 (GRCm39) missense probably benign 0.06
R2845:Fhad1 UTSW 4 141,632,279 (GRCm39) missense probably benign 0.06
R2846:Fhad1 UTSW 4 141,632,279 (GRCm39) missense probably benign 0.06
R2866:Fhad1 UTSW 4 141,648,099 (GRCm39) missense probably benign 0.00
R3119:Fhad1 UTSW 4 141,645,618 (GRCm39) frame shift probably null
R3760:Fhad1 UTSW 4 141,637,124 (GRCm39) missense probably damaging 1.00
R4180:Fhad1 UTSW 4 141,712,854 (GRCm39) missense possibly damaging 0.69
R4466:Fhad1 UTSW 4 141,684,969 (GRCm39) missense probably damaging 1.00
R4627:Fhad1 UTSW 4 141,623,779 (GRCm39) missense possibly damaging 0.47
R4680:Fhad1 UTSW 4 141,738,858 (GRCm39) nonsense probably null
R4725:Fhad1 UTSW 4 141,655,689 (GRCm39) critical splice donor site probably null
R4755:Fhad1 UTSW 4 141,655,794 (GRCm39) missense probably damaging 1.00
R4831:Fhad1 UTSW 4 141,643,378 (GRCm39) splice site probably null
R4909:Fhad1 UTSW 4 141,712,822 (GRCm39) missense probably benign 0.01
R4968:Fhad1 UTSW 4 141,645,618 (GRCm39) missense probably damaging 1.00
R5004:Fhad1 UTSW 4 141,729,910 (GRCm39) critical splice acceptor site probably null
R5036:Fhad1 UTSW 4 141,648,052 (GRCm39) missense probably benign 0.03
R5048:Fhad1 UTSW 4 141,691,987 (GRCm39) critical splice acceptor site probably null
R5416:Fhad1 UTSW 4 141,646,113 (GRCm39) missense probably benign 0.39
R5504:Fhad1 UTSW 4 141,712,846 (GRCm39) missense probably benign
R5586:Fhad1 UTSW 4 141,632,442 (GRCm39) missense probably benign 0.44
R5692:Fhad1 UTSW 4 141,690,768 (GRCm39) missense probably benign 0.00
R5706:Fhad1 UTSW 4 141,681,427 (GRCm39) missense probably damaging 1.00
R5773:Fhad1 UTSW 4 141,656,881 (GRCm39) missense probably damaging 0.99
R5823:Fhad1 UTSW 4 141,682,617 (GRCm39) missense possibly damaging 0.84
R5833:Fhad1 UTSW 4 141,729,838 (GRCm39) missense probably damaging 1.00
R6170:Fhad1 UTSW 4 141,618,263 (GRCm39) nonsense probably null
R6286:Fhad1 UTSW 4 141,648,209 (GRCm39) missense probably damaging 1.00
R6610:Fhad1 UTSW 4 141,643,707 (GRCm39) missense possibly damaging 0.94
R6755:Fhad1 UTSW 4 141,691,915 (GRCm39) missense probably damaging 1.00
R7006:Fhad1 UTSW 4 141,645,602 (GRCm39) frame shift probably null
R7008:Fhad1 UTSW 4 141,645,602 (GRCm39) frame shift probably null
R7012:Fhad1 UTSW 4 141,645,602 (GRCm39) frame shift probably null
R7014:Fhad1 UTSW 4 141,645,602 (GRCm39) frame shift probably null
R7058:Fhad1 UTSW 4 141,645,602 (GRCm39) frame shift probably null
R7059:Fhad1 UTSW 4 141,645,602 (GRCm39) frame shift probably null
R7060:Fhad1 UTSW 4 141,645,602 (GRCm39) frame shift probably null
R7159:Fhad1 UTSW 4 141,678,927 (GRCm39) missense probably benign 0.01
R7472:Fhad1 UTSW 4 141,691,937 (GRCm39) missense probably benign
R7670:Fhad1 UTSW 4 141,678,802 (GRCm39) missense probably benign 0.01
R7694:Fhad1 UTSW 4 141,632,375 (GRCm39) missense probably benign 0.41
R7745:Fhad1 UTSW 4 141,618,250 (GRCm39) missense probably benign 0.00
R7848:Fhad1 UTSW 4 141,632,913 (GRCm39) missense probably benign 0.29
R7853:Fhad1 UTSW 4 141,637,134 (GRCm39) missense probably damaging 0.99
R7867:Fhad1 UTSW 4 141,632,902 (GRCm39) missense probably benign 0.00
R7925:Fhad1 UTSW 4 141,681,498 (GRCm39) missense probably damaging 0.97
R8089:Fhad1 UTSW 4 141,684,971 (GRCm39) missense probably damaging 1.00
R8123:Fhad1 UTSW 4 141,712,836 (GRCm39) missense probably benign 0.02
R8711:Fhad1 UTSW 4 141,684,924 (GRCm39) missense probably benign 0.25
R8751:Fhad1 UTSW 4 141,646,134 (GRCm39) missense probably benign 0.04
R8783:Fhad1 UTSW 4 141,636,403 (GRCm39) missense probably benign 0.02
R8858:Fhad1 UTSW 4 141,666,339 (GRCm39) missense possibly damaging 0.87
R8867:Fhad1 UTSW 4 141,656,885 (GRCm39) missense probably damaging 0.97
R8890:Fhad1 UTSW 4 141,656,902 (GRCm39) missense probably benign 0.01
R8982:Fhad1 UTSW 4 141,729,895 (GRCm39) missense probably damaging 1.00
R9004:Fhad1 UTSW 4 141,649,735 (GRCm39) splice site probably benign
R9021:Fhad1 UTSW 4 141,709,620 (GRCm39) missense probably damaging 0.97
R9190:Fhad1 UTSW 4 141,646,058 (GRCm39) critical splice donor site probably null
R9237:Fhad1 UTSW 4 141,632,483 (GRCm39) missense probably benign 0.11
R9614:Fhad1 UTSW 4 141,678,882 (GRCm39) missense possibly damaging 0.69
R9744:Fhad1 UTSW 4 141,637,124 (GRCm39) missense probably damaging 1.00
X0018:Fhad1 UTSW 4 141,678,927 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTATGCCATCACTTGGGGATGAC -3'
(R):5'- ACCATAAGTAGCTCAGAGTGTGGGG -3'

Sequencing Primer
(F):5'- gatgaaatctgctctgaagcc -3'
(R):5'- TGGACATGTCAGAGCAATGC -3'
Posted On 2014-04-24