Incidental Mutation 'R1584:Mrps35'
ID 177339
Institutional Source Beutler Lab
Gene Symbol Mrps35
Ensembl Gene ENSMUSG00000040112
Gene Name mitochondrial ribosomal protein S35
Synonyms MRPS28, MRP-S28, MDSO23
MMRRC Submission 039621-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock # R1584 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 147042764-147073991 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 147055984 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 169 (T169M)
Ref Sequence ENSEMBL: ENSMUSP00000048348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036111] [ENSMUST00000137556]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000036111
AA Change: T169M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048348
Gene: ENSMUSG00000040112
AA Change: T169M

Pfam:MRP-S28 138 262 2.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143204
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency 99% (106/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that has had confusing nomenclature in the literature. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Pseudogenes corresponding to this gene are found on chromosomes 3p, 5q, and 10q. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,515,410 A71V probably damaging Het
Ager A G 17: 34,600,718 E357G probably damaging Het
Akap13 T C 7: 75,729,049 S2095P possibly damaging Het
Ampd2 T C 3: 108,080,337 probably null Het
Arrdc1 T C 2: 24,925,795 I398V probably benign Het
Ash1l T C 3: 89,052,065 Y2250H probably damaging Het
BC005561 T A 5: 104,518,257 I215N probably damaging Het
Brca2 G A 5: 150,552,258 A2478T probably damaging Het
Btrc T A 19: 45,513,382 probably benign Het
C8g C T 2: 25,500,216 A6T probably benign Het
Cdc123 T A 2: 5,803,977 probably null Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Cldn5 G A 16: 18,777,477 G161D probably damaging Het
Cndp2 G A 18: 84,677,315 probably benign Het
Cntnap1 C A 11: 101,180,360 F366L probably damaging Het
Corin C T 5: 72,302,790 probably null Het
Ctdspl2 G A 2: 122,003,929 R332K probably benign Het
Dido1 G A 2: 180,662,328 P1261L probably damaging Het
Dopey1 A T 9: 86,548,172 R2200* probably null Het
Dtx3l G A 16: 35,932,728 L503F probably damaging Het
Dysf A G 6: 84,067,047 K259R probably benign Het
Enpep T A 3: 129,319,448 T203S probably damaging Het
Epha2 T A 4: 141,322,047 probably null Het
Fam20b T C 1: 156,686,188 probably benign Het
Fbln7 A G 2: 128,877,429 T49A probably benign Het
Fgf14 T A 14: 124,676,539 K60M probably benign Het
Fhad1 T C 4: 141,985,511 I206V probably benign Het
Figla A G 6: 86,020,782 E164G probably benign Het
Gimap4 C A 6: 48,691,282 Q196K probably benign Het
Glcci1 C T 6: 8,537,964 T6I probably damaging Het
Gm6583 C T 5: 112,354,764 G358D probably benign Het
Grk4 T C 5: 34,694,750 S113P probably benign Het
Hectd3 G A 4: 116,996,566 E220K probably damaging Het
Hecw1 A G 13: 14,340,743 probably null Het
Helz2 G A 2: 181,236,297 P903S probably damaging Het
Hydin T C 8: 110,580,815 V3942A probably benign Het
Irs1 G T 1: 82,289,444 H350Q probably benign Het
Kdm1b G A 13: 47,064,054 E46K probably damaging Het
Klf11 A G 12: 24,655,305 N253D probably damaging Het
Klhl23 T C 2: 69,833,888 I527T probably damaging Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lcn4 G A 2: 26,668,576 P166L probably damaging Het
Letmd1 T A 15: 100,472,542 probably null Het
Lilra6 T A 7: 3,912,662 D358V probably damaging Het
Mmrn2 A G 14: 34,375,685 D24G probably benign Het
Mpp5 A G 12: 78,829,727 I482V probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Muc4 G A 16: 32,753,595 G1157D probably benign Het
Naga T A 15: 82,334,788 M237L probably null Het
Nfu1 G A 6: 87,020,809 E225K probably damaging Het
Nin A T 12: 70,042,669 L1324Q probably benign Het
Oc90 T A 15: 65,897,720 Y96F probably damaging Het
Olfr1029 T A 2: 85,975,995 F251I probably damaging Het
Olfr1253 C T 2: 89,752,267 C187Y probably damaging Het
Olfr1471 T C 19: 13,445,659 Y216H probably damaging Het
Olfr25 G A 9: 38,330,131 M181I possibly damaging Het
Olfr522 A G 7: 140,162,203 V249A probably damaging Het
Orc4 A T 2: 48,909,494 C324S possibly damaging Het
Pdzrn4 T C 15: 92,770,537 S857P probably benign Het
Plec C T 15: 76,185,908 E1000K possibly damaging Het
Plvap A T 8: 71,508,481 V149D probably benign Het
Pm20d2 A T 4: 33,174,772 N371K probably damaging Het
Ppp2r5d A G 17: 46,684,684 Y480H probably benign Het
Prkd1 A T 12: 50,425,515 V205E probably damaging Het
R3hdm2 A G 10: 127,476,690 I434V probably benign Het
Rel T A 11: 23,745,546 T246S probably damaging Het
Rnf215 T A 11: 4,136,719 V172E probably damaging Het
Scara3 T C 14: 65,921,104 D485G probably damaging Het
Sec16a A T 2: 26,431,157 Y1308N probably damaging Het
Sis A T 3: 72,932,060 D824E possibly damaging Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Srebf1 C T 11: 60,200,702 R999H probably benign Het
St3gal3 A C 4: 118,107,662 M1R probably null Het
Tapbp C T 17: 33,919,940 probably null Het
Tep1 A T 14: 50,866,037 N265K probably damaging Het
Tln2 T A 9: 67,296,414 N470I probably damaging Het
Trim43a G T 9: 88,588,158 W339L probably damaging Het
Ttc22 T C 4: 106,622,780 F77S probably damaging Het
Ttc8 A G 12: 98,920,764 E32G probably benign Het
Uhmk1 A T 1: 170,208,653 probably null Het
Usp17lc A G 7: 103,418,941 H481R possibly damaging Het
Vamp8 G A 6: 72,385,634 T35M probably damaging Het
Vill A G 9: 119,065,586 Y53C probably damaging Het
Vmn1r222 A T 13: 23,232,762 S94T probably damaging Het
Vmn2r93 A G 17: 18,305,151 Y357C possibly damaging Het
Vps13c T A 9: 67,893,112 V536D possibly damaging Het
Vrtn G A 12: 84,650,081 C535Y probably damaging Het
Vwa3a A G 7: 120,768,165 Y181C probably damaging Het
Wfikkn2 G A 11: 94,238,895 T140I probably damaging Het
Ykt6 T A 11: 5,962,349 F101I probably damaging Het
Zfp277 C T 12: 40,378,826 G174D probably benign Het
Zfp638 A G 6: 83,978,065 probably null Het
Zzef1 C T 11: 72,924,679 P2942S probably damaging Het
Other mutations in Mrps35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00912:Mrps35 APN 6 147055921 missense possibly damaging 0.86
IGL01776:Mrps35 APN 6 147070716 missense probably benign 0.33
IGL02134:Mrps35 APN 6 147048310 splice site probably benign
IGL03382:Mrps35 APN 6 147049875 nonsense probably null
R0600:Mrps35 UTSW 6 147070734 missense possibly damaging 0.53
R0648:Mrps35 UTSW 6 147055945 nonsense probably null
R1466:Mrps35 UTSW 6 147055984 missense probably damaging 0.98
R1466:Mrps35 UTSW 6 147055984 missense probably damaging 0.98
R1655:Mrps35 UTSW 6 147060228 missense possibly damaging 0.84
R2018:Mrps35 UTSW 6 147061484 nonsense probably null
R2257:Mrps35 UTSW 6 147070627 missense possibly damaging 0.85
R4989:Mrps35 UTSW 6 147060147 missense possibly damaging 0.85
R5174:Mrps35 UTSW 6 147060211 missense possibly damaging 0.93
R5453:Mrps35 UTSW 6 147070617 missense probably benign 0.32
R6682:Mrps35 UTSW 6 147048279 missense possibly damaging 0.86
R7181:Mrps35 UTSW 6 147055993 critical splice donor site probably null
R7409:Mrps35 UTSW 6 147055983 missense possibly damaging 0.71
R8132:Mrps35 UTSW 6 147048163 missense probably benign
X0066:Mrps35 UTSW 6 147070720 missense possibly damaging 0.72
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gaaggagagaactaaccccac -3'
Posted On 2014-04-24