Incidental Mutation 'R1584:Cilp'
ID177350
Institutional Source Beutler Lab
Gene Symbol Cilp
Ensembl Gene ENSMUSG00000042254
Gene Namecartilage intermediate layer protein, nucleotide pyrophosphohydrolase
SynonymsC130036G17Rik
MMRRC Submission 039621-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1584 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location65265180-65280605 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65279715 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 1031 (G1031S)
Ref Sequence ENSEMBL: ENSMUSP00000036631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048762] [ENSMUST00000141382]
Predicted Effect probably damaging
Transcript: ENSMUST00000048762
AA Change: G1031S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036631
Gene: ENSMUSG00000042254
AA Change: G1031S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Mucin2_WxxW 55 139 1.9e-24 PFAM
TSP1 152 201 3.09e-10 SMART
low complexity region 233 242 N/A INTRINSIC
IGc2 321 383 4.45e-10 SMART
low complexity region 1154 1170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141382
SMART Domains Protein: ENSMUSP00000121326
Gene: ENSMUSG00000042254

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Meta Mutation Damage Score 0.3480 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency 99% (106/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major alterations in the composition of the cartilage extracellular matrix occur in joint disease, such as osteoarthrosis. This gene encodes the cartilage intermediate layer protein (CILP), which increases in early osteoarthrosis cartilage. The encoded protein was thought to encode a protein precursor for two different proteins; an N-terminal CILP and a C-terminal homolog of NTPPHase, however, later studies identified no nucleotide pyrophosphatase phosphodiesterase (NPP) activity. The full-length and the N-terminal domain of this protein was shown to function as an IGF-1 antagonist. An allelic variant of this gene has been associated with lumbar disc disease. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,515,410 A71V probably damaging Het
Ager A G 17: 34,600,718 E357G probably damaging Het
Akap13 T C 7: 75,729,049 S2095P possibly damaging Het
Ampd2 T C 3: 108,080,337 probably null Het
Arrdc1 T C 2: 24,925,795 I398V probably benign Het
Ash1l T C 3: 89,052,065 Y2250H probably damaging Het
BC005561 T A 5: 104,518,257 I215N probably damaging Het
Brca2 G A 5: 150,552,258 A2478T probably damaging Het
Btrc T A 19: 45,513,382 probably benign Het
C8g C T 2: 25,500,216 A6T probably benign Het
Cdc123 T A 2: 5,803,977 probably null Het
Cldn5 G A 16: 18,777,477 G161D probably damaging Het
Cndp2 G A 18: 84,677,315 probably benign Het
Cntnap1 C A 11: 101,180,360 F366L probably damaging Het
Corin C T 5: 72,302,790 probably null Het
Ctdspl2 G A 2: 122,003,929 R332K probably benign Het
Dido1 G A 2: 180,662,328 P1261L probably damaging Het
Dopey1 A T 9: 86,548,172 R2200* probably null Het
Dtx3l G A 16: 35,932,728 L503F probably damaging Het
Dysf A G 6: 84,067,047 K259R probably benign Het
Enpep T A 3: 129,319,448 T203S probably damaging Het
Epha2 T A 4: 141,322,047 probably null Het
Fam20b T C 1: 156,686,188 probably benign Het
Fbln7 A G 2: 128,877,429 T49A probably benign Het
Fgf14 T A 14: 124,676,539 K60M probably benign Het
Fhad1 T C 4: 141,985,511 I206V probably benign Het
Figla A G 6: 86,020,782 E164G probably benign Het
Gimap4 C A 6: 48,691,282 Q196K probably benign Het
Glcci1 C T 6: 8,537,964 T6I probably damaging Het
Gm6583 C T 5: 112,354,764 G358D probably benign Het
Grk4 T C 5: 34,694,750 S113P probably benign Het
Hectd3 G A 4: 116,996,566 E220K probably damaging Het
Hecw1 A G 13: 14,340,743 probably null Het
Helz2 G A 2: 181,236,297 P903S probably damaging Het
Hydin T C 8: 110,580,815 V3942A probably benign Het
Irs1 G T 1: 82,289,444 H350Q probably benign Het
Kdm1b G A 13: 47,064,054 E46K probably damaging Het
Klf11 A G 12: 24,655,305 N253D probably damaging Het
Klhl23 T C 2: 69,833,888 I527T probably damaging Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lcn4 G A 2: 26,668,576 P166L probably damaging Het
Letmd1 T A 15: 100,472,542 probably null Het
Lilra6 T A 7: 3,912,662 D358V probably damaging Het
Mmrn2 A G 14: 34,375,685 D24G probably benign Het
Mpp5 A G 12: 78,829,727 I482V probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mrps35 C T 6: 147,055,984 T169M probably damaging Het
Muc4 G A 16: 32,753,595 G1157D probably benign Het
Naga T A 15: 82,334,788 M237L probably null Het
Nfu1 G A 6: 87,020,809 E225K probably damaging Het
Nin A T 12: 70,042,669 L1324Q probably benign Het
Oc90 T A 15: 65,897,720 Y96F probably damaging Het
Olfr1029 T A 2: 85,975,995 F251I probably damaging Het
Olfr1253 C T 2: 89,752,267 C187Y probably damaging Het
Olfr1471 T C 19: 13,445,659 Y216H probably damaging Het
Olfr25 G A 9: 38,330,131 M181I possibly damaging Het
Olfr522 A G 7: 140,162,203 V249A probably damaging Het
Orc4 A T 2: 48,909,494 C324S possibly damaging Het
Pdzrn4 T C 15: 92,770,537 S857P probably benign Het
Plec C T 15: 76,185,908 E1000K possibly damaging Het
Plvap A T 8: 71,508,481 V149D probably benign Het
Pm20d2 A T 4: 33,174,772 N371K probably damaging Het
Ppp2r5d A G 17: 46,684,684 Y480H probably benign Het
Prkd1 A T 12: 50,425,515 V205E probably damaging Het
R3hdm2 A G 10: 127,476,690 I434V probably benign Het
Rel T A 11: 23,745,546 T246S probably damaging Het
Rnf215 T A 11: 4,136,719 V172E probably damaging Het
Scara3 T C 14: 65,921,104 D485G probably damaging Het
Sec16a A T 2: 26,431,157 Y1308N probably damaging Het
Sis A T 3: 72,932,060 D824E possibly damaging Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Srebf1 C T 11: 60,200,702 R999H probably benign Het
St3gal3 A C 4: 118,107,662 M1R probably null Het
Tapbp C T 17: 33,919,940 probably null Het
Tep1 A T 14: 50,866,037 N265K probably damaging Het
Tln2 T A 9: 67,296,414 N470I probably damaging Het
Trim43a G T 9: 88,588,158 W339L probably damaging Het
Ttc22 T C 4: 106,622,780 F77S probably damaging Het
Ttc8 A G 12: 98,920,764 E32G probably benign Het
Uhmk1 A T 1: 170,208,653 probably null Het
Usp17lc A G 7: 103,418,941 H481R possibly damaging Het
Vamp8 G A 6: 72,385,634 T35M probably damaging Het
Vill A G 9: 119,065,586 Y53C probably damaging Het
Vmn1r222 A T 13: 23,232,762 S94T probably damaging Het
Vmn2r93 A G 17: 18,305,151 Y357C possibly damaging Het
Vps13c T A 9: 67,893,112 V536D possibly damaging Het
Vrtn G A 12: 84,650,081 C535Y probably damaging Het
Vwa3a A G 7: 120,768,165 Y181C probably damaging Het
Wfikkn2 G A 11: 94,238,895 T140I probably damaging Het
Ykt6 T A 11: 5,962,349 F101I probably damaging Het
Zfp277 C T 12: 40,378,826 G174D probably benign Het
Zfp638 A G 6: 83,978,065 probably null Het
Zzef1 C T 11: 72,924,679 P2942S probably damaging Het
Other mutations in Cilp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Cilp APN 9 65278983 missense possibly damaging 0.80
IGL01340:Cilp APN 9 65275974 missense probably damaging 0.99
IGL02330:Cilp APN 9 65274522 splice site probably benign
IGL02729:Cilp APN 9 65278090 missense possibly damaging 0.63
IGL02833:Cilp APN 9 65277924 missense probably benign
IGL02961:Cilp APN 9 65278609 missense possibly damaging 0.88
IGL03137:Cilp APN 9 65278168 missense probably benign
IGL03211:Cilp APN 9 65280175 missense probably benign
IGL03301:Cilp APN 9 65280217 missense probably benign 0.01
IGL03341:Cilp APN 9 65278002 missense probably benign 0.07
ANU05:Cilp UTSW 9 65278983 missense possibly damaging 0.80
IGL02984:Cilp UTSW 9 65280130 frame shift probably null
IGL02988:Cilp UTSW 9 65280130 frame shift probably null
IGL02991:Cilp UTSW 9 65280130 frame shift probably null
IGL03014:Cilp UTSW 9 65280130 frame shift probably null
IGL03050:Cilp UTSW 9 65280130 frame shift probably null
IGL03054:Cilp UTSW 9 65280130 frame shift probably null
IGL03055:Cilp UTSW 9 65280130 frame shift probably null
IGL03097:Cilp UTSW 9 65280130 frame shift probably null
IGL03098:Cilp UTSW 9 65280130 frame shift probably null
IGL03134:Cilp UTSW 9 65280130 frame shift probably null
IGL03138:Cilp UTSW 9 65280130 frame shift probably null
IGL03147:Cilp UTSW 9 65280130 frame shift probably null
R0096:Cilp UTSW 9 65273670 missense possibly damaging 0.57
R0219:Cilp UTSW 9 65269590 missense possibly damaging 0.64
R0347:Cilp UTSW 9 65280153 missense probably benign
R0699:Cilp UTSW 9 65270326 missense probably damaging 1.00
R1148:Cilp UTSW 9 65280316 missense possibly damaging 0.96
R1148:Cilp UTSW 9 65280316 missense possibly damaging 0.96
R1155:Cilp UTSW 9 65269587 missense probably benign 0.01
R1544:Cilp UTSW 9 65275845 missense probably benign 0.03
R1586:Cilp UTSW 9 65279715 missense probably damaging 1.00
R2055:Cilp UTSW 9 65279715 missense probably damaging 1.00
R2069:Cilp UTSW 9 65278090 missense possibly damaging 0.63
R2070:Cilp UTSW 9 65279095 missense probably damaging 1.00
R2414:Cilp UTSW 9 65274645 splice site probably benign
R4284:Cilp UTSW 9 65278278 missense probably damaging 1.00
R4630:Cilp UTSW 9 65279880 missense probably benign 0.17
R4632:Cilp UTSW 9 65279880 missense probably benign 0.17
R4870:Cilp UTSW 9 65279698 missense probably damaging 1.00
R4908:Cilp UTSW 9 65278020 missense probably benign 0.17
R5568:Cilp UTSW 9 65280233 missense probably benign 0.04
R5621:Cilp UTSW 9 65278791 missense possibly damaging 0.71
R5889:Cilp UTSW 9 65280343 missense possibly damaging 0.93
R6645:Cilp UTSW 9 65279305 missense possibly damaging 0.66
R6878:Cilp UTSW 9 65279847 missense probably damaging 1.00
R6982:Cilp UTSW 9 65279805 missense probably damaging 1.00
R7330:Cilp UTSW 9 65280245 missense probably benign
R7967:Cilp UTSW 9 65278212 missense possibly damaging 0.80
R8305:Cilp UTSW 9 65279004 missense probably damaging 0.98
R8306:Cilp UTSW 9 65279004 missense probably damaging 0.98
R8307:Cilp UTSW 9 65279004 missense probably damaging 0.98
R8308:Cilp UTSW 9 65279004 missense probably damaging 0.98
R8386:Cilp UTSW 9 65279004 missense probably damaging 0.98
R8407:Cilp UTSW 9 65274616 missense probably damaging 1.00
X0024:Cilp UTSW 9 65279643 missense probably damaging 1.00
X0025:Cilp UTSW 9 65279698 missense probably damaging 1.00
Z1088:Cilp UTSW 9 65280130 frame shift probably null
Z1176:Cilp UTSW 9 65280130 frame shift probably null
Z1177:Cilp UTSW 9 65280130 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGAGGTGAATGTACGATCCCGTAAC -3'
(R):5'- AGCCATCGGAAGTGCCATCAAAG -3'

Sequencing Primer
(F):5'- TACGATCCCGTAACATGGGAG -3'
(R):5'- GCAATCTCCTTAGCTGTACGAG -3'
Posted On2014-04-24