Mutagenetix > Incidental Mutations

Incidental Mutation 'R1584:Cilp'

177350

Institutional Source

Beutler Lab

Gene Symbol

Cilp

Ensembl Gene

ENSMUSG00000042254

Gene Name

cartilage intermediate layer protein, nucleotide pyrophosphohydrolase

Synonyms

C130036G17Rik

MMRRC Submission

039621-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1584 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65265180-65280605 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 65279715 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 1031 (G1031S)

Ref Sequence

ENSEMBL: ENSMUSP00000036631 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048762] [ENSMUST00000141382]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048762
AA Change: G1031S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000036631
Gene: ENSMUSG00000042254
AA Change: G1031S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Mucin2_WxxW	55	139	1.9e-24	PFAM
TSP1	152	201	3.09e-10	SMART
low complexity region	233	242	N/A	INTRINSIC
IGc2	321	383	4.45e-10	SMART
low complexity region	1154	1170	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141382

SMART Domains

Protein: ENSMUSP00000121326
Gene: ENSMUSG00000042254

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Meta Mutation Damage Score

0.3480

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.2%

Validation Efficiency

99% (106/107)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major alterations in the composition of the cartilage extracellular matrix occur in joint disease, such as osteoarthrosis. This gene encodes the cartilage intermediate layer protein (CILP), which increases in early osteoarthrosis cartilage. The encoded protein was thought to encode a protein precursor for two different proteins; an N-terminal CILP and a C-terminal homolog of NTPPHase, however, later studies identified no nucleotide pyrophosphatase phosphodiesterase (NPP) activity. The full-length and the N-terminal domain of this protein was shown to function as an IGF-1 antagonist. An allelic variant of this gene has been associated with lumbar disc disease. [provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd15	C	T	11: 77,515,410	A71V	probably damaging	Het
Ager	A	G	17: 34,600,718	E357G	probably damaging	Het
Akap13	T	C	7: 75,729,049	S2095P	possibly damaging	Het
Ampd2	T	C	3: 108,080,337		probably null	Het
Arrdc1	T	C	2: 24,925,795	I398V	probably benign	Het
Ash1l	T	C	3: 89,052,065	Y2250H	probably damaging	Het
BC005561	T	A	5: 104,518,257	I215N	probably damaging	Het
Brca2	G	A	5: 150,552,258	A2478T	probably damaging	Het
Btrc	T	A	19: 45,513,382		probably benign	Het
C8g	C	T	2: 25,500,216	A6T	probably benign	Het
Cdc123	T	A	2: 5,803,977		probably null	Het
Cldn5	G	A	16: 18,777,477	G161D	probably damaging	Het
Cndp2	G	A	18: 84,677,315		probably benign	Het
Cntnap1	C	A	11: 101,180,360	F366L	probably damaging	Het
Corin	C	T	5: 72,302,790		probably null	Het
Ctdspl2	G	A	2: 122,003,929	R332K	probably benign	Het
Dido1	G	A	2: 180,662,328	P1261L	probably damaging	Het
Dopey1	A	T	9: 86,548,172	R2200*	probably null	Het
Dtx3l	G	A	16: 35,932,728	L503F	probably damaging	Het
Dysf	A	G	6: 84,067,047	K259R	probably benign	Het
Enpep	T	A	3: 129,319,448	T203S	probably damaging	Het
Epha2	T	A	4: 141,322,047		probably null	Het
Fam20b	T	C	1: 156,686,188		probably benign	Het
Fbln7	A	G	2: 128,877,429	T49A	probably benign	Het
Fgf14	T	A	14: 124,676,539	K60M	probably benign	Het
Fhad1	T	C	4: 141,985,511	I206V	probably benign	Het
Figla	A	G	6: 86,020,782	E164G	probably benign	Het
Gimap4	C	A	6: 48,691,282	Q196K	probably benign	Het
Glcci1	C	T	6: 8,537,964	T6I	probably damaging	Het
Gm6583	C	T	5: 112,354,764	G358D	probably benign	Het
Grk4	T	C	5: 34,694,750	S113P	probably benign	Het
Hectd3	G	A	4: 116,996,566	E220K	probably damaging	Het
Hecw1	A	G	13: 14,340,743		probably null	Het
Helz2	G	A	2: 181,236,297	P903S	probably damaging	Het
Hydin	T	C	8: 110,580,815	V3942A	probably benign	Het
Irs1	G	T	1: 82,289,444	H350Q	probably benign	Het
Kdm1b	G	A	13: 47,064,054	E46K	probably damaging	Het
Klf11	A	G	12: 24,655,305	N253D	probably damaging	Het
Klhl23	T	C	2: 69,833,888	I527T	probably damaging	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lcn4	G	A	2: 26,668,576	P166L	probably damaging	Het
Letmd1	T	A	15: 100,472,542		probably null	Het
Lilra6	T	A	7: 3,912,662	D358V	probably damaging	Het
Mmrn2	A	G	14: 34,375,685	D24G	probably benign	Het
Mpp5	A	G	12: 78,829,727	I482V	probably benign	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Mrps35	C	T	6: 147,055,984	T169M	probably damaging	Het
Muc4	G	A	16: 32,753,595	G1157D	probably benign	Het
Naga	T	A	15: 82,334,788	M237L	probably null	Het
Nfu1	G	A	6: 87,020,809	E225K	probably damaging	Het
Nin	A	T	12: 70,042,669	L1324Q	probably benign	Het
Oc90	T	A	15: 65,897,720	Y96F	probably damaging	Het
Olfr1029	T	A	2: 85,975,995	F251I	probably damaging	Het
Olfr1253	C	T	2: 89,752,267	C187Y	probably damaging	Het
Olfr1471	T	C	19: 13,445,659	Y216H	probably damaging	Het
Olfr25	G	A	9: 38,330,131	M181I	possibly damaging	Het
Olfr522	A	G	7: 140,162,203	V249A	probably damaging	Het
Orc4	A	T	2: 48,909,494	C324S	possibly damaging	Het
Pdzrn4	T	C	15: 92,770,537	S857P	probably benign	Het
Plec	C	T	15: 76,185,908	E1000K	possibly damaging	Het
Plvap	A	T	8: 71,508,481	V149D	probably benign	Het
Pm20d2	A	T	4: 33,174,772	N371K	probably damaging	Het
Ppp2r5d	A	G	17: 46,684,684	Y480H	probably benign	Het
Prkd1	A	T	12: 50,425,515	V205E	probably damaging	Het
R3hdm2	A	G	10: 127,476,690	I434V	probably benign	Het
Rel	T	A	11: 23,745,546	T246S	probably damaging	Het
Rnf215	T	A	11: 4,136,719	V172E	probably damaging	Het
Scara3	T	C	14: 65,921,104	D485G	probably damaging	Het
Sec16a	A	T	2: 26,431,157	Y1308N	probably damaging	Het
Sis	A	T	3: 72,932,060	D824E	possibly damaging	Het
Slc27a4	T	A	2: 29,811,190	V331E	probably damaging	Het
Srebf1	C	T	11: 60,200,702	R999H	probably benign	Het
St3gal3	A	C	4: 118,107,662	M1R	probably null	Het
Tapbp	C	T	17: 33,919,940		probably null	Het
Tep1	A	T	14: 50,866,037	N265K	probably damaging	Het
Tln2	T	A	9: 67,296,414	N470I	probably damaging	Het
Trim43a	G	T	9: 88,588,158	W339L	probably damaging	Het
Ttc22	T	C	4: 106,622,780	F77S	probably damaging	Het
Ttc8	A	G	12: 98,920,764	E32G	probably benign	Het
Uhmk1	A	T	1: 170,208,653		probably null	Het
Usp17lc	A	G	7: 103,418,941	H481R	possibly damaging	Het
Vamp8	G	A	6: 72,385,634	T35M	probably damaging	Het
Vill	A	G	9: 119,065,586	Y53C	probably damaging	Het
Vmn1r222	A	T	13: 23,232,762	S94T	probably damaging	Het
Vmn2r93	A	G	17: 18,305,151	Y357C	possibly damaging	Het
Vps13c	T	A	9: 67,893,112	V536D	possibly damaging	Het
Vrtn	G	A	12: 84,650,081	C535Y	probably damaging	Het
Vwa3a	A	G	7: 120,768,165	Y181C	probably damaging	Het
Wfikkn2	G	A	11: 94,238,895	T140I	probably damaging	Het
Ykt6	T	A	11: 5,962,349	F101I	probably damaging	Het
Zfp277	C	T	12: 40,378,826	G174D	probably benign	Het
Zfp638	A	G	6: 83,978,065		probably null	Het
Zzef1	C	T	11: 72,924,679	P2942S	probably damaging	Het

Other mutations in Cilp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01291:Cilp	APN	9	65278983	missense	possibly damaging	0.80
IGL01340:Cilp	APN	9	65275974	missense	probably damaging	0.99
IGL02330:Cilp	APN	9	65274522	splice site	probably benign
IGL02729:Cilp	APN	9	65278090	missense	possibly damaging	0.63
IGL02833:Cilp	APN	9	65277924	missense	probably benign
IGL02961:Cilp	APN	9	65278609	missense	possibly damaging	0.88
IGL03137:Cilp	APN	9	65278168	missense	probably benign
IGL03211:Cilp	APN	9	65280175	missense	probably benign
IGL03301:Cilp	APN	9	65280217	missense	probably benign	0.01
IGL03341:Cilp	APN	9	65278002	missense	probably benign	0.07
ANU05:Cilp	UTSW	9	65278983	missense	possibly damaging	0.80
IGL02984:Cilp	UTSW	9	65280130	frame shift	probably null
IGL02988:Cilp	UTSW	9	65280130	frame shift	probably null
IGL02991:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03014:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03050:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03054:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03055:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03097:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03098:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03134:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03138:Cilp	UTSW	9	65280130	frame shift	probably null
IGL03147:Cilp	UTSW	9	65280130	frame shift	probably null
R0096:Cilp	UTSW	9	65273670	missense	possibly damaging	0.57
R0219:Cilp	UTSW	9	65269590	missense	possibly damaging	0.64
R0347:Cilp	UTSW	9	65280153	missense	probably benign
R0699:Cilp	UTSW	9	65270326	missense	probably damaging	1.00
R1148:Cilp	UTSW	9	65280316	missense	possibly damaging	0.96
R1148:Cilp	UTSW	9	65280316	missense	possibly damaging	0.96
R1155:Cilp	UTSW	9	65269587	missense	probably benign	0.01
R1544:Cilp	UTSW	9	65275845	missense	probably benign	0.03
R1586:Cilp	UTSW	9	65279715	missense	probably damaging	1.00
R2055:Cilp	UTSW	9	65279715	missense	probably damaging	1.00
R2069:Cilp	UTSW	9	65278090	missense	possibly damaging	0.63
R2070:Cilp	UTSW	9	65279095	missense	probably damaging	1.00
R2414:Cilp	UTSW	9	65274645	splice site	probably benign
R4284:Cilp	UTSW	9	65278278	missense	probably damaging	1.00
R4630:Cilp	UTSW	9	65279880	missense	probably benign	0.17
R4632:Cilp	UTSW	9	65279880	missense	probably benign	0.17
R4870:Cilp	UTSW	9	65279698	missense	probably damaging	1.00
R4908:Cilp	UTSW	9	65278020	missense	probably benign	0.17
R5568:Cilp	UTSW	9	65280233	missense	probably benign	0.04
R5621:Cilp	UTSW	9	65278791	missense	possibly damaging	0.71
R5889:Cilp	UTSW	9	65280343	missense	possibly damaging	0.93
R6645:Cilp	UTSW	9	65279305	missense	possibly damaging	0.66
R6878:Cilp	UTSW	9	65279847	missense	probably damaging	1.00
R6982:Cilp	UTSW	9	65279805	missense	probably damaging	1.00
R7330:Cilp	UTSW	9	65280245	missense	probably benign
R7967:Cilp	UTSW	9	65278212	missense	possibly damaging	0.80
R8305:Cilp	UTSW	9	65279004	missense	probably damaging	0.98
R8306:Cilp	UTSW	9	65279004	missense	probably damaging	0.98
R8307:Cilp	UTSW	9	65279004	missense	probably damaging	0.98
R8308:Cilp	UTSW	9	65279004	missense	probably damaging	0.98
R8386:Cilp	UTSW	9	65279004	missense	probably damaging	0.98
R8407:Cilp	UTSW	9	65274616	missense	probably damaging	1.00
R8542:Cilp	UTSW	9	65278123	missense	probably damaging	1.00
R8794:Cilp	UTSW	9	65279253	missense	probably benign	0.26
R8951:Cilp	UTSW	9	65272938	missense	probably benign	0.01
R9060:Cilp	UTSW	9	65279020	missense	probably benign	0.01
X0024:Cilp	UTSW	9	65279643	missense	probably damaging	1.00
X0025:Cilp	UTSW	9	65279698	missense	probably damaging	1.00
Z1088:Cilp	UTSW	9	65280130	frame shift	probably null
Z1176:Cilp	UTSW	9	65280130	frame shift	probably null
Z1177:Cilp	UTSW	9	65280130	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GGAGGTGAATGTACGATCCCGTAAC -3'
(R):5'- AGCCATCGGAAGTGCCATCAAAG -3'

Sequencing Primer
(F):5'- TACGATCCCGTAACATGGGAG -3'
(R):5'- GCAATCTCCTTAGCTGTACGAG -3'

Posted On

2014-04-24