Incidental Mutation 'R1584:Dopey1'
ID177353
Institutional Source Beutler Lab
Gene Symbol Dopey1
Ensembl Gene ENSMUSG00000034973
Gene Namedopey family member 1
SynonymsB130005I07Rik, D9Ertd809e
MMRRC Submission 039621-MU
Accession Numbers

Genbank: NM_177208; MGI: 1289294

Is this an essential gene? Possibly non essential (E-score: 0.473) question?
Stock #R1584 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location86467154-86555923 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 86548172 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 2200 (R2200*)
Ref Sequence ENSEMBL: ENSMUSP00000140740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034987] [ENSMUST00000185919] [ENSMUST00000189817] [ENSMUST00000190957]
Predicted Effect probably null
Transcript: ENSMUST00000034987
AA Change: R2200*
SMART Domains Protein: ENSMUSP00000034987
Gene: ENSMUSG00000034973
AA Change: R2200*

DomainStartEndE-ValueType
Pfam:Dopey_N 11 300 1e-117 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185919
SMART Domains Protein: ENSMUSP00000140040
Gene: ENSMUSG00000034973

DomainStartEndE-ValueType
Pfam:Dopey_N 10 306 1.9e-106 PFAM
low complexity region 629 647 N/A INTRINSIC
low complexity region 959 971 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1294 1316 N/A INTRINSIC
low complexity region 1333 1342 N/A INTRINSIC
low complexity region 1360 1371 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189564
Predicted Effect probably benign
Transcript: ENSMUST00000189817
Predicted Effect probably null
Transcript: ENSMUST00000190957
AA Change: R2200*
SMART Domains Protein: ENSMUSP00000140740
Gene: ENSMUSG00000034973
AA Change: R2200*

DomainStartEndE-ValueType
Pfam:Dopey_N 10 305 1.3e-108 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194439
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency 99% (106/107)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,515,410 A71V probably damaging Het
Ager A G 17: 34,600,718 E357G probably damaging Het
Akap13 T C 7: 75,729,049 S2095P possibly damaging Het
Ampd2 T C 3: 108,080,337 probably null Het
Arrdc1 T C 2: 24,925,795 I398V probably benign Het
Ash1l T C 3: 89,052,065 Y2250H probably damaging Het
BC005561 T A 5: 104,518,257 I215N probably damaging Het
Brca2 G A 5: 150,552,258 A2478T probably damaging Het
Btrc T A 19: 45,513,382 probably benign Het
C8g C T 2: 25,500,216 A6T probably benign Het
Cdc123 T A 2: 5,803,977 probably null Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Cldn5 G A 16: 18,777,477 G161D probably damaging Het
Cndp2 G A 18: 84,677,315 probably benign Het
Cntnap1 C A 11: 101,180,360 F366L probably damaging Het
Corin C T 5: 72,302,790 probably null Het
Ctdspl2 G A 2: 122,003,929 R332K probably benign Het
Dido1 G A 2: 180,662,328 P1261L probably damaging Het
Dtx3l G A 16: 35,932,728 L503F probably damaging Het
Dysf A G 6: 84,067,047 K259R probably benign Het
Enpep T A 3: 129,319,448 T203S probably damaging Het
Epha2 T A 4: 141,322,047 probably null Het
Fam20b T C 1: 156,686,188 probably benign Het
Fbln7 A G 2: 128,877,429 T49A probably benign Het
Fgf14 T A 14: 124,676,539 K60M probably benign Het
Fhad1 T C 4: 141,985,511 I206V probably benign Het
Figla A G 6: 86,020,782 E164G probably benign Het
Gimap4 C A 6: 48,691,282 Q196K probably benign Het
Glcci1 C T 6: 8,537,964 T6I probably damaging Het
Gm6583 C T 5: 112,354,764 G358D probably benign Het
Grk4 T C 5: 34,694,750 S113P probably benign Het
Hectd3 G A 4: 116,996,566 E220K probably damaging Het
Hecw1 A G 13: 14,340,743 probably null Het
Helz2 G A 2: 181,236,297 P903S probably damaging Het
Hydin T C 8: 110,580,815 V3942A probably benign Het
Irs1 G T 1: 82,289,444 H350Q probably benign Het
Kdm1b G A 13: 47,064,054 E46K probably damaging Het
Klf11 A G 12: 24,655,305 N253D probably damaging Het
Klhl23 T C 2: 69,833,888 I527T probably damaging Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lcn4 G A 2: 26,668,576 P166L probably damaging Het
Letmd1 T A 15: 100,472,542 probably null Het
Lilra6 T A 7: 3,912,662 D358V probably damaging Het
Mmrn2 A G 14: 34,375,685 D24G probably benign Het
Mpp5 A G 12: 78,829,727 I482V probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mrps35 C T 6: 147,055,984 T169M probably damaging Het
Muc4 G A 16: 32,753,595 G1157D probably benign Het
Naga T A 15: 82,334,788 M237L probably null Het
Nfu1 G A 6: 87,020,809 E225K probably damaging Het
Nin A T 12: 70,042,669 L1324Q probably benign Het
Oc90 T A 15: 65,897,720 Y96F probably damaging Het
Olfr1029 T A 2: 85,975,995 F251I probably damaging Het
Olfr1253 C T 2: 89,752,267 C187Y probably damaging Het
Olfr1471 T C 19: 13,445,659 Y216H probably damaging Het
Olfr25 G A 9: 38,330,131 M181I possibly damaging Het
Olfr522 A G 7: 140,162,203 V249A probably damaging Het
Orc4 A T 2: 48,909,494 C324S possibly damaging Het
Pdzrn4 T C 15: 92,770,537 S857P probably benign Het
Plec C T 15: 76,185,908 E1000K possibly damaging Het
Plvap A T 8: 71,508,481 V149D probably benign Het
Pm20d2 A T 4: 33,174,772 N371K probably damaging Het
Ppp2r5d A G 17: 46,684,684 Y480H probably benign Het
Prkd1 A T 12: 50,425,515 V205E probably damaging Het
R3hdm2 A G 10: 127,476,690 I434V probably benign Het
Rel T A 11: 23,745,546 T246S probably damaging Het
Rnf215 T A 11: 4,136,719 V172E probably damaging Het
Scara3 T C 14: 65,921,104 D485G probably damaging Het
Sec16a A T 2: 26,431,157 Y1308N probably damaging Het
Sis A T 3: 72,932,060 D824E possibly damaging Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Srebf1 C T 11: 60,200,702 R999H probably benign Het
St3gal3 A C 4: 118,107,662 M1R probably null Het
Tapbp C T 17: 33,919,940 probably null Het
Tep1 A T 14: 50,866,037 N265K probably damaging Het
Tln2 T A 9: 67,296,414 N470I probably damaging Het
Trim43a G T 9: 88,588,158 W339L probably damaging Het
Ttc22 T C 4: 106,622,780 F77S probably damaging Het
Ttc8 A G 12: 98,920,764 E32G probably benign Het
Uhmk1 A T 1: 170,208,653 probably null Het
Usp17lc A G 7: 103,418,941 H481R possibly damaging Het
Vamp8 G A 6: 72,385,634 T35M probably damaging Het
Vill A G 9: 119,065,586 Y53C probably damaging Het
Vmn1r222 A T 13: 23,232,762 S94T probably damaging Het
Vmn2r93 A G 17: 18,305,151 Y357C possibly damaging Het
Vps13c T A 9: 67,893,112 V536D possibly damaging Het
Vrtn G A 12: 84,650,081 C535Y probably damaging Het
Vwa3a A G 7: 120,768,165 Y181C probably damaging Het
Wfikkn2 G A 11: 94,238,895 T140I probably damaging Het
Ykt6 T A 11: 5,962,349 F101I probably damaging Het
Zfp277 C T 12: 40,378,826 G174D probably benign Het
Zfp638 A G 6: 83,978,065 probably null Het
Zzef1 C T 11: 72,924,679 P2942S probably damaging Het
Other mutations in Dopey1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dopey1 APN 9 86551679 missense possibly damaging 0.57
IGL00427:Dopey1 APN 9 86521500 missense probably benign 0.09
IGL00427:Dopey1 APN 9 86521498 missense possibly damaging 0.93
IGL00427:Dopey1 APN 9 86521499 missense probably damaging 0.96
IGL00577:Dopey1 APN 9 86520946 missense probably damaging 1.00
IGL00741:Dopey1 APN 9 86522806 missense possibly damaging 0.50
IGL00959:Dopey1 APN 9 86487431 missense probably damaging 1.00
IGL01339:Dopey1 APN 9 86551677 missense possibly damaging 0.90
IGL01608:Dopey1 APN 9 86507561 missense probably benign 0.23
IGL01760:Dopey1 APN 9 86519923 missense probably benign
IGL01788:Dopey1 APN 9 86531719 missense probably benign 0.03
IGL01844:Dopey1 APN 9 86514085 missense probably damaging 1.00
IGL01923:Dopey1 APN 9 86522867 missense probably damaging 1.00
IGL02036:Dopey1 APN 9 86531765 missense probably benign 0.18
IGL02308:Dopey1 APN 9 86520088 missense probably damaging 0.98
IGL02494:Dopey1 APN 9 86526818 missense probably damaging 1.00
IGL02698:Dopey1 APN 9 86524359 splice site probably benign
IGL02731:Dopey1 APN 9 86487381 missense probably damaging 1.00
IGL02821:Dopey1 APN 9 86520156 missense probably benign
IGL02952:Dopey1 APN 9 86532922 splice site probably benign
IGL03071:Dopey1 APN 9 86489615 missense possibly damaging 0.91
IGL03271:Dopey1 APN 9 86504222 nonsense probably null
IGL03344:Dopey1 APN 9 86536144 missense probably damaging 1.00
Beg UTSW 9 86548172 nonsense probably null
groak UTSW 9 86521657 missense probably damaging 1.00
R0055:Dopey1 UTSW 9 86512652 missense probably benign 0.08
R0285:Dopey1 UTSW 9 86512639 missense probably damaging 1.00
R0415:Dopey1 UTSW 9 86506502 missense probably damaging 1.00
R0427:Dopey1 UTSW 9 86507532 missense probably damaging 1.00
R0514:Dopey1 UTSW 9 86520734 missense probably damaging 1.00
R0538:Dopey1 UTSW 9 86485497 missense probably damaging 1.00
R1118:Dopey1 UTSW 9 86515406 missense probably damaging 1.00
R1158:Dopey1 UTSW 9 86485556 missense probably damaging 1.00
R1272:Dopey1 UTSW 9 86521424 missense probably damaging 1.00
R1448:Dopey1 UTSW 9 86542732 splice site probably null
R1601:Dopey1 UTSW 9 86536250 missense probably damaging 0.99
R1674:Dopey1 UTSW 9 86536160 missense probably damaging 0.98
R1706:Dopey1 UTSW 9 86554080 missense possibly damaging 0.92
R1856:Dopey1 UTSW 9 86492004 missense probably damaging 0.99
R1926:Dopey1 UTSW 9 86523019 missense probably damaging 1.00
R1929:Dopey1 UTSW 9 86494418 missense probably damaging 1.00
R2029:Dopey1 UTSW 9 86521365 missense probably damaging 1.00
R2125:Dopey1 UTSW 9 86521046 missense probably damaging 1.00
R2206:Dopey1 UTSW 9 86521599 missense probably benign 0.00
R2271:Dopey1 UTSW 9 86494418 missense probably damaging 1.00
R2312:Dopey1 UTSW 9 86521442 nonsense probably null
R2379:Dopey1 UTSW 9 86521085 missense probably damaging 1.00
R2507:Dopey1 UTSW 9 86513117 missense probably damaging 1.00
R3737:Dopey1 UTSW 9 86494433 missense probably damaging 1.00
R3804:Dopey1 UTSW 9 86520995 missense probably damaging 1.00
R3916:Dopey1 UTSW 9 86521133 missense probably damaging 1.00
R3921:Dopey1 UTSW 9 86520271 missense probably benign 0.06
R4035:Dopey1 UTSW 9 86494433 missense probably damaging 1.00
R4392:Dopey1 UTSW 9 86503143 intron probably benign
R4404:Dopey1 UTSW 9 86522813 nonsense probably null
R4513:Dopey1 UTSW 9 86520559 missense probably benign 0.39
R4624:Dopey1 UTSW 9 86521525 missense probably damaging 1.00
R4659:Dopey1 UTSW 9 86502032 intron probably benign
R4910:Dopey1 UTSW 9 86492061 missense probably damaging 1.00
R4919:Dopey1 UTSW 9 86520056 missense possibly damaging 0.47
R5061:Dopey1 UTSW 9 86503108 splice site probably benign
R5079:Dopey1 UTSW 9 86487421 missense probably damaging 1.00
R5118:Dopey1 UTSW 9 86506259 missense probably damaging 1.00
R5169:Dopey1 UTSW 9 86533021 missense probably damaging 1.00
R5176:Dopey1 UTSW 9 86521815 missense probably damaging 1.00
R5190:Dopey1 UTSW 9 86487304 missense probably damaging 1.00
R5256:Dopey1 UTSW 9 86515328 missense probably damaging 1.00
R5346:Dopey1 UTSW 9 86520782 missense probably damaging 1.00
R5484:Dopey1 UTSW 9 86545288 missense probably damaging 1.00
R5501:Dopey1 UTSW 9 86507730 missense probably benign 0.04
R5554:Dopey1 UTSW 9 86521657 missense probably damaging 1.00
R5707:Dopey1 UTSW 9 86502997 missense possibly damaging 0.95
R5826:Dopey1 UTSW 9 86507570 missense possibly damaging 0.94
R5921:Dopey1 UTSW 9 86501922 missense probably damaging 1.00
R5934:Dopey1 UTSW 9 86542442 nonsense probably null
R5936:Dopey1 UTSW 9 86536512 nonsense probably null
R6046:Dopey1 UTSW 9 86515343 missense probably damaging 1.00
R6053:Dopey1 UTSW 9 86515294 missense possibly damaging 0.95
R6072:Dopey1 UTSW 9 86507697 missense probably benign 0.00
R6104:Dopey1 UTSW 9 86520807 missense possibly damaging 0.86
R6125:Dopey1 UTSW 9 86521133 missense probably damaging 1.00
R6299:Dopey1 UTSW 9 86504212 missense probably damaging 1.00
R6930:Dopey1 UTSW 9 86531772 critical splice donor site probably null
R6949:Dopey1 UTSW 9 86500860 missense probably damaging 1.00
R6979:Dopey1 UTSW 9 86521642 missense possibly damaging 0.77
R7035:Dopey1 UTSW 9 86524302 missense possibly damaging 0.85
R7069:Dopey1 UTSW 9 86550169 critical splice donor site probably null
R7101:Dopey1 UTSW 9 86507669 missense probably benign
R7202:Dopey1 UTSW 9 86504167 splice site probably null
R7222:Dopey1 UTSW 9 86522876 critical splice donor site probably null
R7233:Dopey1 UTSW 9 86521696 missense probably benign 0.00
R7236:Dopey1 UTSW 9 86515378 missense probably damaging 1.00
R7252:Dopey1 UTSW 9 86500821 missense probably damaging 1.00
R7268:Dopey1 UTSW 9 86512777 nonsense probably null
R7353:Dopey1 UTSW 9 86512859 missense probably damaging 0.99
R7481:Dopey1 UTSW 9 86535932 missense probably damaging 1.00
R7498:Dopey1 UTSW 9 86494411 missense possibly damaging 0.95
R7507:Dopey1 UTSW 9 86535949 missense probably benign 0.01
R7525:Dopey1 UTSW 9 86506290 missense probably damaging 1.00
R7539:Dopey1 UTSW 9 86521573 missense probably benign 0.03
R7751:Dopey1 UTSW 9 86507730 missense probably benign 0.00
R7753:Dopey1 UTSW 9 86489702 missense possibly damaging 0.52
R7839:Dopey1 UTSW 9 86542765 nonsense probably null
R7868:Dopey1 UTSW 9 86501984 critical splice donor site probably null
R8061:Dopey1 UTSW 9 86521193 missense possibly damaging 0.95
R8067:Dopey1 UTSW 9 86518339 missense probably benign 0.00
R8156:Dopey1 UTSW 9 86494457 missense probably damaging 1.00
R8196:Dopey1 UTSW 9 86523098 missense probably benign 0.12
R8223:Dopey1 UTSW 9 86518292 missense probably damaging 1.00
R8267:Dopey1 UTSW 9 86514001 missense possibly damaging 0.81
R8276:Dopey1 UTSW 9 86517039 missense probably benign
R8306:Dopey1 UTSW 9 86520206 missense possibly damaging 0.94
R8353:Dopey1 UTSW 9 86521586 missense probably damaging 0.97
R8362:Dopey1 UTSW 9 86513888 missense probably benign 0.02
R8403:Dopey1 UTSW 9 86500872 missense probably damaging 1.00
R8817:Dopey1 UTSW 9 86513950 missense possibly damaging 0.91
R8862:Dopey1 UTSW 9 86524351 critical splice donor site probably null
R8888:Dopey1 UTSW 9 86521534 missense probably benign
R8972:Dopey1 UTSW 9 86521247 missense possibly damaging 0.50
R9001:Dopey1 UTSW 9 86554321 makesense probably null
R9011:Dopey1 UTSW 9 86515343 missense probably damaging 1.00
R9021:Dopey1 UTSW 9 86520437 missense probably benign 0.35
R9039:Dopey1 UTSW 9 86500817 missense probably damaging 0.99
RF004:Dopey1 UTSW 9 86554191 missense probably benign
X0019:Dopey1 UTSW 9 86506227 missense probably damaging 1.00
X0019:Dopey1 UTSW 9 86531750 missense probably damaging 0.98
ZE80:Dopey1 UTSW 9 86500842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAAGGGCTCACATGAAAGTG -3'
(R):5'- GGCAGTTGGTTACCTACACAACTCG -3'

Sequencing Primer
(F):5'- tgcttgcttgcttgcttg -3'
(R):5'- TACTTAGGCGCATGGAATCTGAC -3'
Posted On2014-04-24