Mutagenetix > Incidental Mutations

Incidental Mutation 'R1584:Tep1'

177377

Institutional Source

Beutler Lab

Gene Symbol

Tep1

Ensembl Gene

ENSMUSG00000006281

Gene Name

telomerase associated protein 1

Synonyms

Tp1

MMRRC Submission

039621-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1584 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

50824059-50870560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 50866037 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 265 (N265K)

Ref Sequence

ENSEMBL: ENSMUSP00000006444 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006444]

Predicted Effect

probably damaging
Transcript: ENSMUST00000006444
AA Change: N265K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281
AA Change: N265K

Domain	Start	End	E-Value	Type
Pfam:TEP1_N	1	29	2.8e-20	PFAM
Pfam:TEP1_N	31	59	1.4e-20	PFAM
Pfam:TEP1_N	61	89	3.1e-20	PFAM
Pfam:TEP1_N	91	119	3e-20	PFAM
low complexity region	195	207	N/A	INTRINSIC
low complexity region	211	229	N/A	INTRINSIC
Pfam:TROVE	230	685	3.2e-136	PFAM
Pfam:DUF4062	909	1020	2.4e-22	PFAM
Pfam:NACHT	1171	1346	9.2e-38	PFAM
low complexity region	1393	1405	N/A	INTRINSIC
low complexity region	1622	1641	N/A	INTRINSIC
WD40	1673	1711	2.98e-1	SMART
WD40	1714	1752	5.33e0	SMART
WD40	1755	1794	1.52e-4	SMART
WD40	1797	1835	3.27e-4	SMART
WD40	1838	1877	3.09e-1	SMART
WD40	1880	1919	2.24e-2	SMART
WD40	1925	1962	4.95e0	SMART
WD40	1968	2003	2.29e1	SMART
WD40	2008	2045	1.72e0	SMART
WD40	2058	2097	3.89e-11	SMART
WD40	2103	2142	3.93e-7	SMART
WD40	2145	2182	4.38e-5	SMART
WD40	2184	2232	1.24e0	SMART
WD40	2235	2273	1.14e-3	SMART
WD40	2275	2315	4.46e-1	SMART
Blast:WD40	2316	2353	4e-12	BLAST
WD40	2546	2583	6.79e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181482

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181697

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227103

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227207

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227351

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228078

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228254

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.2%

Validation Efficiency

99% (106/107)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene show no obvious phenotype. No changes are seen in telomerase activity or telomere length. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd15	C	T	11: 77,515,410	A71V	probably damaging	Het
Ager	A	G	17: 34,600,718	E357G	probably damaging	Het
Akap13	T	C	7: 75,729,049	S2095P	possibly damaging	Het
Ampd2	T	C	3: 108,080,337		probably null	Het
Arrdc1	T	C	2: 24,925,795	I398V	probably benign	Het
Ash1l	T	C	3: 89,052,065	Y2250H	probably damaging	Het
BC005561	T	A	5: 104,518,257	I215N	probably damaging	Het
Brca2	G	A	5: 150,552,258	A2478T	probably damaging	Het
Btrc	T	A	19: 45,513,382		probably benign	Het
C8g	C	T	2: 25,500,216	A6T	probably benign	Het
Cdc123	T	A	2: 5,803,977		probably null	Het
Cilp	G	A	9: 65,279,715	G1031S	probably damaging	Het
Cldn5	G	A	16: 18,777,477	G161D	probably damaging	Het
Cndp2	G	A	18: 84,677,315		probably benign	Het
Cntnap1	C	A	11: 101,180,360	F366L	probably damaging	Het
Corin	C	T	5: 72,302,790		probably null	Het
Ctdspl2	G	A	2: 122,003,929	R332K	probably benign	Het
Dido1	G	A	2: 180,662,328	P1261L	probably damaging	Het
Dopey1	A	T	9: 86,548,172	R2200*	probably null	Het
Dtx3l	G	A	16: 35,932,728	L503F	probably damaging	Het
Dysf	A	G	6: 84,067,047	K259R	probably benign	Het
Enpep	T	A	3: 129,319,448	T203S	probably damaging	Het
Epha2	T	A	4: 141,322,047		probably null	Het
Fam20b	T	C	1: 156,686,188		probably benign	Het
Fbln7	A	G	2: 128,877,429	T49A	probably benign	Het
Fgf14	T	A	14: 124,676,539	K60M	probably benign	Het
Fhad1	T	C	4: 141,985,511	I206V	probably benign	Het
Figla	A	G	6: 86,020,782	E164G	probably benign	Het
Gimap4	C	A	6: 48,691,282	Q196K	probably benign	Het
Glcci1	C	T	6: 8,537,964	T6I	probably damaging	Het
Gm6583	C	T	5: 112,354,764	G358D	probably benign	Het
Grk4	T	C	5: 34,694,750	S113P	probably benign	Het
Hectd3	G	A	4: 116,996,566	E220K	probably damaging	Het
Hecw1	A	G	13: 14,340,743		probably null	Het
Helz2	G	A	2: 181,236,297	P903S	probably damaging	Het
Hydin	T	C	8: 110,580,815	V3942A	probably benign	Het
Irs1	G	T	1: 82,289,444	H350Q	probably benign	Het
Kdm1b	G	A	13: 47,064,054	E46K	probably damaging	Het
Klf11	A	G	12: 24,655,305	N253D	probably damaging	Het
Klhl23	T	C	2: 69,833,888	I527T	probably damaging	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lcn4	G	A	2: 26,668,576	P166L	probably damaging	Het
Letmd1	T	A	15: 100,472,542		probably null	Het
Lilra6	T	A	7: 3,912,662	D358V	probably damaging	Het
Mmrn2	A	G	14: 34,375,685	D24G	probably benign	Het
Mpp5	A	G	12: 78,829,727	I482V	probably benign	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Mrps35	C	T	6: 147,055,984	T169M	probably damaging	Het
Muc4	G	A	16: 32,753,595	G1157D	probably benign	Het
Naga	T	A	15: 82,334,788	M237L	probably null	Het
Nfu1	G	A	6: 87,020,809	E225K	probably damaging	Het
Nin	A	T	12: 70,042,669	L1324Q	probably benign	Het
Oc90	T	A	15: 65,897,720	Y96F	probably damaging	Het
Olfr1029	T	A	2: 85,975,995	F251I	probably damaging	Het
Olfr1253	C	T	2: 89,752,267	C187Y	probably damaging	Het
Olfr1471	T	C	19: 13,445,659	Y216H	probably damaging	Het
Olfr25	G	A	9: 38,330,131	M181I	possibly damaging	Het
Olfr522	A	G	7: 140,162,203	V249A	probably damaging	Het
Orc4	A	T	2: 48,909,494	C324S	possibly damaging	Het
Pdzrn4	T	C	15: 92,770,537	S857P	probably benign	Het
Plec	C	T	15: 76,185,908	E1000K	possibly damaging	Het
Plvap	A	T	8: 71,508,481	V149D	probably benign	Het
Pm20d2	A	T	4: 33,174,772	N371K	probably damaging	Het
Ppp2r5d	A	G	17: 46,684,684	Y480H	probably benign	Het
Prkd1	A	T	12: 50,425,515	V205E	probably damaging	Het
R3hdm2	A	G	10: 127,476,690	I434V	probably benign	Het
Rel	T	A	11: 23,745,546	T246S	probably damaging	Het
Rnf215	T	A	11: 4,136,719	V172E	probably damaging	Het
Scara3	T	C	14: 65,921,104	D485G	probably damaging	Het
Sec16a	A	T	2: 26,431,157	Y1308N	probably damaging	Het
Sis	A	T	3: 72,932,060	D824E	possibly damaging	Het
Slc27a4	T	A	2: 29,811,190	V331E	probably damaging	Het
Srebf1	C	T	11: 60,200,702	R999H	probably benign	Het
St3gal3	A	C	4: 118,107,662	M1R	probably null	Het
Tapbp	C	T	17: 33,919,940		probably null	Het
Tln2	T	A	9: 67,296,414	N470I	probably damaging	Het
Trim43a	G	T	9: 88,588,158	W339L	probably damaging	Het
Ttc22	T	C	4: 106,622,780	F77S	probably damaging	Het
Ttc8	A	G	12: 98,920,764	E32G	probably benign	Het
Uhmk1	A	T	1: 170,208,653		probably null	Het
Usp17lc	A	G	7: 103,418,941	H481R	possibly damaging	Het
Vamp8	G	A	6: 72,385,634	T35M	probably damaging	Het
Vill	A	G	9: 119,065,586	Y53C	probably damaging	Het
Vmn1r222	A	T	13: 23,232,762	S94T	probably damaging	Het
Vmn2r93	A	G	17: 18,305,151	Y357C	possibly damaging	Het
Vps13c	T	A	9: 67,893,112	V536D	possibly damaging	Het
Vrtn	G	A	12: 84,650,081	C535Y	probably damaging	Het
Vwa3a	A	G	7: 120,768,165	Y181C	probably damaging	Het
Wfikkn2	G	A	11: 94,238,895	T140I	probably damaging	Het
Ykt6	T	A	11: 5,962,349	F101I	probably damaging	Het
Zfp277	C	T	12: 40,378,826	G174D	probably benign	Het
Zfp638	A	G	6: 83,978,065		probably null	Het
Zzef1	C	T	11: 72,924,679	P2942S	probably damaging	Het

Other mutations in Tep1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Tep1	APN	14	50843184	missense	probably damaging	1.00
IGL00490:Tep1	APN	14	50833473	missense	probably damaging	0.97
IGL01114:Tep1	APN	14	50850639	missense	probably damaging	0.98
IGL01294:Tep1	APN	14	50829657	splice site	probably benign
IGL01902:Tep1	APN	14	50866091	splice site	probably benign
IGL01910:Tep1	APN	14	50844112	missense	probably benign	0.06
IGL01925:Tep1	APN	14	50824498	unclassified	probably benign
IGL01965:Tep1	APN	14	50863495	splice site	probably benign
IGL02071:Tep1	APN	14	50834049	missense	possibly damaging	0.93
IGL02124:Tep1	APN	14	50854124	unclassified	probably benign
IGL02189:Tep1	APN	14	50826826	missense	probably benign
IGL02252:Tep1	APN	14	50830255	missense	possibly damaging	0.93
IGL02299:Tep1	APN	14	50840671	missense	probably damaging	0.99
IGL02343:Tep1	APN	14	50829247	missense	probably damaging	0.99
IGL02423:Tep1	APN	14	50844620	missense	possibly damaging	0.53
IGL02537:Tep1	APN	14	50836113	missense	probably damaging	0.96
IGL02601:Tep1	APN	14	50833478	nonsense	probably null
IGL02941:Tep1	APN	14	50866037	missense	probably damaging	0.98
IGL02990:Tep1	APN	14	50868246	missense	possibly damaging	0.86
IGL03144:Tep1	APN	14	50844017	splice site	probably benign
IGL03209:Tep1	APN	14	50840703	splice site	probably benign
PIT4305001:Tep1	UTSW	14	50829227	missense	possibly damaging	0.90
PIT4362001:Tep1	UTSW	14	50866053	missense	probably benign	0.23
R0058:Tep1	UTSW	14	50834065	missense	possibly damaging	0.85
R0060:Tep1	UTSW	14	50866029	missense	probably damaging	1.00
R0109:Tep1	UTSW	14	50851916	splice site	probably null
R0123:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0134:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0148:Tep1	UTSW	14	50824789	missense	possibly damaging	0.70
R0240:Tep1	UTSW	14	50863029	splice site	probably benign
R0243:Tep1	UTSW	14	50846987	missense	probably damaging	1.00
R0373:Tep1	UTSW	14	50836768	missense	possibly damaging	0.85
R0432:Tep1	UTSW	14	50866823	small deletion	probably benign
R0464:Tep1	UTSW	14	50847684	missense	probably benign	0.00
R0566:Tep1	UTSW	14	50845414	critical splice donor site	probably null
R0691:Tep1	UTSW	14	50866844	nonsense	probably null
R0787:Tep1	UTSW	14	50829230	missense	possibly damaging	0.85
R0972:Tep1	UTSW	14	50824296	unclassified	probably benign
R1263:Tep1	UTSW	14	50845513	missense	possibly damaging	0.84
R1300:Tep1	UTSW	14	50827055	critical splice donor site	probably null
R1327:Tep1	UTSW	14	50853099	missense	probably benign	0.18
R1556:Tep1	UTSW	14	50853042	missense	probably benign	0.06
R1607:Tep1	UTSW	14	50824563	missense	probably null	0.99
R1686:Tep1	UTSW	14	50836788	missense	probably benign	0.12
R1715:Tep1	UTSW	14	50854567	missense	possibly damaging	0.92
R1778:Tep1	UTSW	14	50829622	intron	probably benign
R1993:Tep1	UTSW	14	50824184	missense	possibly damaging	0.93
R2071:Tep1	UTSW	14	50854282	missense	probably benign	0.23
R2104:Tep1	UTSW	14	50850580	splice site	probably benign
R2118:Tep1	UTSW	14	50855572	intron	probably null
R2119:Tep1	UTSW	14	50838986	missense	probably benign	0.13
R2208:Tep1	UTSW	14	50866864	missense	probably benign	0.01
R2241:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2243:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2311:Tep1	UTSW	14	50833567	missense	possibly damaging	0.95
R2420:Tep1	UTSW	14	50834023	missense	probably benign
R2874:Tep1	UTSW	14	50850650	missense	possibly damaging	0.71
R3084:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3086:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3621:Tep1	UTSW	14	50829020	missense	probably damaging	0.99
R3815:Tep1	UTSW	14	50868315	missense	possibly damaging	0.71
R4124:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4125:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4127:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4134:Tep1	UTSW	14	50844860	missense	probably benign
R4152:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4153:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4191:Tep1	UTSW	14	50836806	missense	probably damaging	0.96
R4248:Tep1	UTSW	14	50862894	missense	possibly damaging	0.93
R4293:Tep1	UTSW	14	50846861	missense	probably benign
R4569:Tep1	UTSW	14	50824740	missense	probably benign	0.01
R4704:Tep1	UTSW	14	50837073	missense	probably benign	0.06
R4815:Tep1	UTSW	14	50841302	missense	probably damaging	0.99
R4978:Tep1	UTSW	14	50845434	missense	possibly damaging	0.93
R4989:Tep1	UTSW	14	50839000	missense	probably benign
R5022:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5057:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5063:Tep1	UTSW	14	50850627	missense	possibly damaging	0.86
R5118:Tep1	UTSW	14	50855587	splice site	probably null
R5128:Tep1	UTSW	14	50844279	makesense	probably null
R5149:Tep1	UTSW	14	50837398	nonsense	probably null
R5171:Tep1	UTSW	14	50824802	missense	probably benign	0.01
R5201:Tep1	UTSW	14	50868110	missense	probably benign	0.01
R5260:Tep1	UTSW	14	50838631	missense	probably benign
R5339:Tep1	UTSW	14	50844574	missense	probably damaging	0.99
R5384:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5385:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5386:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5594:Tep1	UTSW	14	50829882	missense	possibly damaging	0.86
R5639:Tep1	UTSW	14	50853605	missense	possibly damaging	0.85
R5749:Tep1	UTSW	14	50844072	missense	possibly damaging	0.59
R5756:Tep1	UTSW	14	50837379	critical splice donor site	probably null
R6013:Tep1	UTSW	14	50861048	missense	probably damaging	0.97
R6014:Tep1	UTSW	14	50847000	missense	probably benign	0.12
R6248:Tep1	UTSW	14	50830258	missense	probably damaging	0.98
R6264:Tep1	UTSW	14	50845513	missense	probably damaging	0.99
R6363:Tep1	UTSW	14	50824548	missense	probably benign	0.04
R6381:Tep1	UTSW	14	50845431	missense	probably damaging	0.99
R6462:Tep1	UTSW	14	50844379	missense	probably benign
R6942:Tep1	UTSW	14	50836737	missense	possibly damaging	0.85
R6951:Tep1	UTSW	14	50833913	critical splice donor site	probably null
R6979:Tep1	UTSW	14	50838637	missense	possibly damaging	0.93
R6999:Tep1	UTSW	14	50850705	missense	possibly damaging	0.86
R7099:Tep1	UTSW	14	50844487	intron	probably null
R7208:Tep1	UTSW	14	50824556	critical splice acceptor site	probably null
R7232:Tep1	UTSW	14	50844332	missense	unknown
R7249:Tep1	UTSW	14	50824275	missense	possibly damaging	0.86
R7325:Tep1	UTSW	14	50866038	missense	probably damaging	0.99
R7409:Tep1	UTSW	14	50866855	missense	possibly damaging	0.67
R7499:Tep1	UTSW	14	50853590	missense	probably damaging	0.99
R7542:Tep1	UTSW	14	50862491	nonsense	probably null
R7806:Tep1	UTSW	14	50836809	missense	possibly damaging	0.85
R7825:Tep1	UTSW	14	50843887	critical splice acceptor site	probably null
R7901:Tep1	UTSW	14	50826851	missense	possibly damaging	0.88
R7984:Tep1	UTSW	14	50826851	missense	possibly damaging	0.88
R8009:Tep1	UTSW	14	50824230	missense	possibly damaging	0.93
RF007:Tep1	UTSW	14	50860945	missense	possibly damaging	0.92
X0024:Tep1	UTSW	14	50827119	missense	possibly damaging	0.86
X0060:Tep1	UTSW	14	50836764	missense	probably benign	0.25
Z1177:Tep1	UTSW	14	50847765	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAGCCAATAACCAGCTCTTCGTACC -3'
(R):5'- AGGGAAAAGATCCCGTTTCCTGC -3'

Sequencing Primer
(F):5'- TAACCAGCTCTTCGTACCATAATTAC -3'
(R):5'- tgggaggcagaggcagg -3'

Posted On

2014-04-24