Incidental Mutation 'R1584:Oc90'
ID 177381
Institutional Source Beutler Lab
Gene Symbol Oc90
Ensembl Gene ENSMUSG00000015001
Gene Name otoconin 90
Synonyms PLA2L, Ocn-95, Pla2ll
MMRRC Submission 039621-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R1584 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 65747902-65784246 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65769569 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 96 (Y96F)
Ref Sequence ENSEMBL: ENSMUSP00000078709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060522] [ENSMUST00000079776]
AlphaFold Q9Z0L3
Predicted Effect probably damaging
Transcript: ENSMUST00000060522
AA Change: Y96F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062865
Gene: ENSMUSG00000015001
AA Change: Y96F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PA2c 74 190 1.75e-15 SMART
PA2c 314 429 3.5e-15 SMART
low complexity region 446 458 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079776
AA Change: Y96F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078709
Gene: ENSMUSG00000015001
AA Change: Y96F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PA2c 74 190 1.75e-15 SMART
PA2c 282 397 3.5e-15 SMART
low complexity region 414 426 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000156996
AA Change: Y79F
SMART Domains Protein: ENSMUSP00000121227
Gene: ENSMUSG00000015001
AA Change: Y79F

DomainStartEndE-ValueType
PA2c 58 174 1.75e-15 SMART
PA2c 283 398 3.5e-15 SMART
low complexity region 415 427 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Meta Mutation Damage Score 0.8547 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency 99% (106/107)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit reduced, enlarged, and loose otoliths, and thin cupula, saccule, utricle and tectorial membranes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,406,236 (GRCm39) A71V probably damaging Het
Ager A G 17: 34,819,692 (GRCm39) E357G probably damaging Het
Akap13 T C 7: 75,378,797 (GRCm39) S2095P possibly damaging Het
Ampd2 T C 3: 107,987,653 (GRCm39) probably null Het
Arrdc1 T C 2: 24,815,807 (GRCm39) I398V probably benign Het
Ash1l T C 3: 88,959,372 (GRCm39) Y2250H probably damaging Het
Brca2 G A 5: 150,475,723 (GRCm39) A2478T probably damaging Het
Btrc T A 19: 45,501,821 (GRCm39) probably benign Het
C8g C T 2: 25,390,228 (GRCm39) A6T probably benign Het
Ccdc121rt3 C T 5: 112,502,630 (GRCm39) G358D probably benign Het
Cdc123 T A 2: 5,808,788 (GRCm39) probably null Het
Cilp G A 9: 65,186,997 (GRCm39) G1031S probably damaging Het
Cldn5 G A 16: 18,596,227 (GRCm39) G161D probably damaging Het
Cndp2 G A 18: 84,695,440 (GRCm39) probably benign Het
Cntnap1 C A 11: 101,071,186 (GRCm39) F366L probably damaging Het
Corin C T 5: 72,460,133 (GRCm39) probably null Het
Ctdspl2 G A 2: 121,834,410 (GRCm39) R332K probably benign Het
Dido1 G A 2: 180,304,121 (GRCm39) P1261L probably damaging Het
Dop1a A T 9: 86,430,225 (GRCm39) R2200* probably null Het
Dtx3l G A 16: 35,753,098 (GRCm39) L503F probably damaging Het
Dysf A G 6: 84,044,029 (GRCm39) K259R probably benign Het
Enpep T A 3: 129,113,097 (GRCm39) T203S probably damaging Het
Epha2 T A 4: 141,049,358 (GRCm39) probably null Het
Fam20b T C 1: 156,513,758 (GRCm39) probably benign Het
Fbln7 A G 2: 128,719,349 (GRCm39) T49A probably benign Het
Fgf14 T A 14: 124,913,951 (GRCm39) K60M probably benign Het
Fhad1 T C 4: 141,712,822 (GRCm39) I206V probably benign Het
Figla A G 6: 85,997,764 (GRCm39) E164G probably benign Het
Gimap4 C A 6: 48,668,216 (GRCm39) Q196K probably benign Het
Glcci1 C T 6: 8,537,964 (GRCm39) T6I probably damaging Het
Grk4 T C 5: 34,852,094 (GRCm39) S113P probably benign Het
Hectd3 G A 4: 116,853,763 (GRCm39) E220K probably damaging Het
Hecw1 A G 13: 14,515,328 (GRCm39) probably null Het
Helz2 G A 2: 180,878,090 (GRCm39) P903S probably damaging Het
Hydin T C 8: 111,307,447 (GRCm39) V3942A probably benign Het
Irs1 G T 1: 82,267,165 (GRCm39) H350Q probably benign Het
Kdm1b G A 13: 47,217,530 (GRCm39) E46K probably damaging Het
Klf11 A G 12: 24,705,304 (GRCm39) N253D probably damaging Het
Klhl23 T C 2: 69,664,232 (GRCm39) I527T probably damaging Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lcn4 G A 2: 26,558,588 (GRCm39) P166L probably damaging Het
Letmd1 T A 15: 100,370,423 (GRCm39) probably null Het
Lilra6 T A 7: 3,915,661 (GRCm39) D358V probably damaging Het
Mmrn2 A G 14: 34,097,642 (GRCm39) D24G probably benign Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Mrps35 C T 6: 146,957,482 (GRCm39) T169M probably damaging Het
Muc4 G A 16: 32,574,886 (GRCm39) G1157D probably benign Het
Naga T A 15: 82,218,989 (GRCm39) M237L probably null Het
Nfu1 G A 6: 86,997,791 (GRCm39) E225K probably damaging Het
Nin A T 12: 70,089,443 (GRCm39) L1324Q probably benign Het
Or4a80 C T 2: 89,582,611 (GRCm39) C187Y probably damaging Het
Or5b116 T C 19: 13,423,023 (GRCm39) Y216H probably damaging Het
Or5m11b T A 2: 85,806,339 (GRCm39) F251I probably damaging Het
Or6ae1 A G 7: 139,742,116 (GRCm39) V249A probably damaging Het
Or8c9 G A 9: 38,241,427 (GRCm39) M181I possibly damaging Het
Orc4 A T 2: 48,799,506 (GRCm39) C324S possibly damaging Het
Pals1 A G 12: 78,876,501 (GRCm39) I482V probably benign Het
Pdzrn4 T C 15: 92,668,418 (GRCm39) S857P probably benign Het
Plec C T 15: 76,070,108 (GRCm39) E1000K possibly damaging Het
Plvap A T 8: 71,961,125 (GRCm39) V149D probably benign Het
Pm20d2 A T 4: 33,174,772 (GRCm39) N371K probably damaging Het
Ppp2r5d A G 17: 46,995,610 (GRCm39) Y480H probably benign Het
Prkd1 A T 12: 50,472,298 (GRCm39) V205E probably damaging Het
R3hdm2 A G 10: 127,312,559 (GRCm39) I434V probably benign Het
Rel T A 11: 23,695,546 (GRCm39) T246S probably damaging Het
Rnf215 T A 11: 4,086,719 (GRCm39) V172E probably damaging Het
Scara3 T C 14: 66,158,553 (GRCm39) D485G probably damaging Het
Sec16a A T 2: 26,321,169 (GRCm39) Y1308N probably damaging Het
Sis A T 3: 72,839,393 (GRCm39) D824E possibly damaging Het
Slc27a4 T A 2: 29,701,202 (GRCm39) V331E probably damaging Het
Srebf1 C T 11: 60,091,528 (GRCm39) R999H probably benign Het
St3gal3 A C 4: 117,964,859 (GRCm39) M1R probably null Het
Tapbp C T 17: 34,138,914 (GRCm39) probably null Het
Tep1 A T 14: 51,103,494 (GRCm39) N265K probably damaging Het
Thoc2l T A 5: 104,666,123 (GRCm39) I215N probably damaging Het
Tln2 T A 9: 67,203,696 (GRCm39) N470I probably damaging Het
Trim43a G T 9: 88,470,211 (GRCm39) W339L probably damaging Het
Ttc22 T C 4: 106,479,977 (GRCm39) F77S probably damaging Het
Ttc8 A G 12: 98,887,023 (GRCm39) E32G probably benign Het
Uhmk1 A T 1: 170,036,222 (GRCm39) probably null Het
Usp17lc A G 7: 103,068,148 (GRCm39) H481R possibly damaging Het
Vamp8 G A 6: 72,362,617 (GRCm39) T35M probably damaging Het
Vill A G 9: 118,894,654 (GRCm39) Y53C probably damaging Het
Vmn1r222 A T 13: 23,416,932 (GRCm39) S94T probably damaging Het
Vmn2r93 A G 17: 18,525,413 (GRCm39) Y357C possibly damaging Het
Vps13c T A 9: 67,800,394 (GRCm39) V536D possibly damaging Het
Vrtn G A 12: 84,696,855 (GRCm39) C535Y probably damaging Het
Vwa3a A G 7: 120,367,388 (GRCm39) Y181C probably damaging Het
Wfikkn2 G A 11: 94,129,721 (GRCm39) T140I probably damaging Het
Ykt6 T A 11: 5,912,349 (GRCm39) F101I probably damaging Het
Zfp277 C T 12: 40,428,825 (GRCm39) G174D probably benign Het
Zfp638 A G 6: 83,955,047 (GRCm39) probably null Het
Zzef1 C T 11: 72,815,505 (GRCm39) P2942S probably damaging Het
Other mutations in Oc90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Oc90 APN 15 65,761,440 (GRCm39) missense probably benign 0.00
IGL01746:Oc90 APN 15 65,761,250 (GRCm39) splice site probably benign
IGL02101:Oc90 APN 15 65,769,638 (GRCm39) missense probably damaging 1.00
IGL02175:Oc90 APN 15 65,755,674 (GRCm39) missense possibly damaging 0.96
IGL02691:Oc90 APN 15 65,754,410 (GRCm39) missense probably damaging 1.00
IGL02947:Oc90 APN 15 65,759,983 (GRCm39) missense probably benign 0.16
R0010:Oc90 UTSW 15 65,748,397 (GRCm39) missense probably damaging 1.00
R0325:Oc90 UTSW 15 65,769,514 (GRCm39) critical splice donor site probably null
R1466:Oc90 UTSW 15 65,769,569 (GRCm39) missense probably damaging 1.00
R1466:Oc90 UTSW 15 65,769,569 (GRCm39) missense probably damaging 1.00
R1496:Oc90 UTSW 15 65,748,370 (GRCm39) missense probably damaging 1.00
R1837:Oc90 UTSW 15 65,761,529 (GRCm39) missense probably damaging 1.00
R3552:Oc90 UTSW 15 65,750,650 (GRCm39) missense possibly damaging 0.81
R4018:Oc90 UTSW 15 65,759,457 (GRCm39) missense probably benign 0.00
R4515:Oc90 UTSW 15 65,764,242 (GRCm39) missense probably damaging 0.96
R4700:Oc90 UTSW 15 65,753,354 (GRCm39) missense possibly damaging 0.91
R4828:Oc90 UTSW 15 65,753,408 (GRCm39) missense probably damaging 1.00
R5135:Oc90 UTSW 15 65,755,679 (GRCm39) missense probably benign 0.00
R5320:Oc90 UTSW 15 65,754,457 (GRCm39) missense probably benign 0.06
R5727:Oc90 UTSW 15 65,753,388 (GRCm39) missense possibly damaging 0.61
R5837:Oc90 UTSW 15 65,748,295 (GRCm39) missense probably benign 0.03
R6086:Oc90 UTSW 15 65,761,560 (GRCm39) missense probably damaging 1.00
R6807:Oc90 UTSW 15 65,761,463 (GRCm39) missense probably damaging 1.00
R8499:Oc90 UTSW 15 65,753,405 (GRCm39) missense probably damaging 1.00
R9213:Oc90 UTSW 15 65,761,557 (GRCm39) nonsense probably null
R9364:Oc90 UTSW 15 65,761,437 (GRCm39) missense probably benign 0.09
R9554:Oc90 UTSW 15 65,761,437 (GRCm39) missense probably benign 0.09
R9631:Oc90 UTSW 15 65,769,629 (GRCm39) missense probably damaging 1.00
Z1177:Oc90 UTSW 15 65,748,196 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAAGAGATGAGTACCAGTTGCCC -3'
(R):5'- AGCTGCATTTGACTGACTACACCG -3'

Sequencing Primer
(F):5'- AGATGAGTACCAGTTGCCCTTTAG -3'
(R):5'- GGAAGAAACTCCTCATGCACTTG -3'
Posted On 2014-04-24