Mutagenetix > Incidental Mutation

Incidental Mutation 'R1584:Pdzrn4'

177384

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

MMRRC Submission

039621-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.324) question?

Stock #

R1584 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92770537 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 857 (S857P)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

probably benign
Transcript: ENSMUST00000035399
AA Change: S618P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: S618P

Domain	Start	End	E-Value	Type
Blast:PDZ	1	56	4e-24	BLAST
SCOP:d1qaua_	20	61	1e-3	SMART
PDB:1UHP\|A	21	64	9e-12	PDB
PDZ	154	229	3.01e-18	SMART
low complexity region	240	259	N/A	INTRINSIC
low complexity region	267	278	N/A	INTRINSIC
coiled coil region	394	430	N/A	INTRINSIC
low complexity region	563	577	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	732	741	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169942
AA Change: S857P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: S857P

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Meta Mutation Damage Score

0.0606

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.2%

Validation Efficiency

99% (106/107)

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd15	C	T	11: 77,515,410	A71V	probably damaging	Het
Ager	A	G	17: 34,600,718	E357G	probably damaging	Het
Akap13	T	C	7: 75,729,049	S2095P	possibly damaging	Het
Ampd2	T	C	3: 108,080,337		probably null	Het
Arrdc1	T	C	2: 24,925,795	I398V	probably benign	Het
Ash1l	T	C	3: 89,052,065	Y2250H	probably damaging	Het
BC005561	T	A	5: 104,518,257	I215N	probably damaging	Het
Brca2	G	A	5: 150,552,258	A2478T	probably damaging	Het
Btrc	T	A	19: 45,513,382		probably benign	Het
C8g	C	T	2: 25,500,216	A6T	probably benign	Het
Cdc123	T	A	2: 5,803,977		probably null	Het
Cilp	G	A	9: 65,279,715	G1031S	probably damaging	Het
Cldn5	G	A	16: 18,777,477	G161D	probably damaging	Het
Cndp2	G	A	18: 84,677,315		probably benign	Het
Cntnap1	C	A	11: 101,180,360	F366L	probably damaging	Het
Corin	C	T	5: 72,302,790		probably null	Het
Ctdspl2	G	A	2: 122,003,929	R332K	probably benign	Het
Dido1	G	A	2: 180,662,328	P1261L	probably damaging	Het
Dopey1	A	T	9: 86,548,172	R2200*	probably null	Het
Dtx3l	G	A	16: 35,932,728	L503F	probably damaging	Het
Dysf	A	G	6: 84,067,047	K259R	probably benign	Het
Enpep	T	A	3: 129,319,448	T203S	probably damaging	Het
Epha2	T	A	4: 141,322,047		probably null	Het
Fam20b	T	C	1: 156,686,188		probably benign	Het
Fbln7	A	G	2: 128,877,429	T49A	probably benign	Het
Fgf14	T	A	14: 124,676,539	K60M	probably benign	Het
Fhad1	T	C	4: 141,985,511	I206V	probably benign	Het
Figla	A	G	6: 86,020,782	E164G	probably benign	Het
Gimap4	C	A	6: 48,691,282	Q196K	probably benign	Het
Glcci1	C	T	6: 8,537,964	T6I	probably damaging	Het
Gm6583	C	T	5: 112,354,764	G358D	probably benign	Het
Grk4	T	C	5: 34,694,750	S113P	probably benign	Het
Hectd3	G	A	4: 116,996,566	E220K	probably damaging	Het
Hecw1	A	G	13: 14,340,743		probably null	Het
Helz2	G	A	2: 181,236,297	P903S	probably damaging	Het
Hydin	T	C	8: 110,580,815	V3942A	probably benign	Het
Irs1	G	T	1: 82,289,444	H350Q	probably benign	Het
Kdm1b	G	A	13: 47,064,054	E46K	probably damaging	Het
Klf11	A	G	12: 24,655,305	N253D	probably damaging	Het
Klhl23	T	C	2: 69,833,888	I527T	probably damaging	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lcn4	G	A	2: 26,668,576	P166L	probably damaging	Het
Letmd1	T	A	15: 100,472,542		probably null	Het
Lilra6	T	A	7: 3,912,662	D358V	probably damaging	Het
Mmrn2	A	G	14: 34,375,685	D24G	probably benign	Het
Mpp5	A	G	12: 78,829,727	I482V	probably benign	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Mrps35	C	T	6: 147,055,984	T169M	probably damaging	Het
Muc4	G	A	16: 32,753,595	G1157D	probably benign	Het
Naga	T	A	15: 82,334,788	M237L	probably null	Het
Nfu1	G	A	6: 87,020,809	E225K	probably damaging	Het
Nin	A	T	12: 70,042,669	L1324Q	probably benign	Het
Oc90	T	A	15: 65,897,720	Y96F	probably damaging	Het
Olfr1029	T	A	2: 85,975,995	F251I	probably damaging	Het
Olfr1253	C	T	2: 89,752,267	C187Y	probably damaging	Het
Olfr1471	T	C	19: 13,445,659	Y216H	probably damaging	Het
Olfr25	G	A	9: 38,330,131	M181I	possibly damaging	Het
Olfr522	A	G	7: 140,162,203	V249A	probably damaging	Het
Orc4	A	T	2: 48,909,494	C324S	possibly damaging	Het
Plec	C	T	15: 76,185,908	E1000K	possibly damaging	Het
Plvap	A	T	8: 71,508,481	V149D	probably benign	Het
Pm20d2	A	T	4: 33,174,772	N371K	probably damaging	Het
Ppp2r5d	A	G	17: 46,684,684	Y480H	probably benign	Het
Prkd1	A	T	12: 50,425,515	V205E	probably damaging	Het
R3hdm2	A	G	10: 127,476,690	I434V	probably benign	Het
Rel	T	A	11: 23,745,546	T246S	probably damaging	Het
Rnf215	T	A	11: 4,136,719	V172E	probably damaging	Het
Scara3	T	C	14: 65,921,104	D485G	probably damaging	Het
Sec16a	A	T	2: 26,431,157	Y1308N	probably damaging	Het
Sis	A	T	3: 72,932,060	D824E	possibly damaging	Het
Slc27a4	T	A	2: 29,811,190	V331E	probably damaging	Het
Srebf1	C	T	11: 60,200,702	R999H	probably benign	Het
St3gal3	A	C	4: 118,107,662	M1R	probably null	Het
Tapbp	C	T	17: 33,919,940		probably null	Het
Tep1	A	T	14: 50,866,037	N265K	probably damaging	Het
Tln2	T	A	9: 67,296,414	N470I	probably damaging	Het
Trim43a	G	T	9: 88,588,158	W339L	probably damaging	Het
Ttc22	T	C	4: 106,622,780	F77S	probably damaging	Het
Ttc8	A	G	12: 98,920,764	E32G	probably benign	Het
Uhmk1	A	T	1: 170,208,653		probably null	Het
Usp17lc	A	G	7: 103,418,941	H481R	possibly damaging	Het
Vamp8	G	A	6: 72,385,634	T35M	probably damaging	Het
Vill	A	G	9: 119,065,586	Y53C	probably damaging	Het
Vmn1r222	A	T	13: 23,232,762	S94T	probably damaging	Het
Vmn2r93	A	G	17: 18,305,151	Y357C	possibly damaging	Het
Vps13c	T	A	9: 67,893,112	V536D	possibly damaging	Het
Vrtn	G	A	12: 84,650,081	C535Y	probably damaging	Het
Vwa3a	A	G	7: 120,768,165	Y181C	probably damaging	Het
Wfikkn2	G	A	11: 94,238,895	T140I	probably damaging	Het
Ykt6	T	A	11: 5,962,349	F101I	probably damaging	Het
Zfp277	C	T	12: 40,378,826	G174D	probably benign	Het
Zfp638	A	G	6: 83,978,065		probably null	Het
Zzef1	C	T	11: 72,924,679	P2942S	probably damaging	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9555:Pdzrn4	UTSW	15	92399822	missense	probably damaging	1.00
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
R9796:Pdzrn4	UTSW	15	92680472	missense	possibly damaging	0.93
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CAAAGCCACCGATGAAGGTTGC -3'
(R):5'- CTCAGTTCGATGATGCTCAGCTCC -3'

Sequencing Primer
(F):5'- GTCTAGAAAGCAGCCAGCTTC -3'
(R):5'- TTTGAGGCTCTCCAGCCG -3'

Posted On

2014-04-24