Incidental Mutation 'R1584:Tapbp'
ID177392
Institutional Source Beutler Lab
Gene Symbol Tapbp
Ensembl Gene ENSMUSG00000024308
Gene NameTAP binding protein
SynonymsTPN, tapasin, D17Wsu91e
MMRRC Submission 039621-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1584 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33915899-33929288 bp(+) (GRCm38)
Type of Mutationunclassified (4422 bp from exon)
DNA Base Change (assembly) C to T at 33919940 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000053429] [ENSMUST00000079421] [ENSMUST00000170075] [ENSMUST00000172619] [ENSMUST00000174146] [ENSMUST00000174463] [ENSMUST00000174541]
Predicted Effect probably benign
Transcript: ENSMUST00000025161
AA Change: A36V

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308
AA Change: A36V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000053429
SMART Domains Protein: ENSMUSP00000057466
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
BTB 57 151 7.21e-22 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 317 355 N/A INTRINSIC
low complexity region 390 403 N/A INTRINSIC
low complexity region 431 443 N/A INTRINSIC
low complexity region 460 479 N/A INTRINSIC
ZnF_C2H2 483 504 1.24e2 SMART
ZnF_C2H2 510 532 1.28e-3 SMART
ZnF_C2H2 538 559 4.69e0 SMART
low complexity region 567 587 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000079421
SMART Domains Protein: ENSMUSP00000078390
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Daxx 54 152 1.3e-51 PFAM
Blast:KISc 185 261 2e-17 BLAST
PDB:4H9S|F 189 404 1e-131 PDB
SCOP:d1sig__ 437 493 7e-3 SMART
low complexity region 573 584 N/A INTRINSIC
low complexity region 693 715 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170075
SMART Domains Protein: ENSMUSP00000128504
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172489
SMART Domains Protein: ENSMUSP00000133332
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
IG 18 142 3.45e0 SMART
SCOP:d2fbjh2 143 189 2e-3 SMART
Blast:IG_like 152 206 6e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172619
AA Change: A27V

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134695
Gene: ENSMUSG00000024308
AA Change: A27V

DomainStartEndE-ValueType
PDB:3F8U|D 12 119 1e-38 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173279
Predicted Effect probably null
Transcript: ENSMUST00000174146
SMART Domains Protein: ENSMUSP00000134158
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174463
SMART Domains Protein: ENSMUSP00000133345
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
Pfam:BTB 47 87 7.9e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174541
SMART Domains Protein: ENSMUSP00000133552
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 702 1.5e-297 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189156
Meta Mutation Damage Score 0.7182 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency 99% (106/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane glycoprotein which mediates interaction between newly assembled major histocompatibility complex (MHC) class I molecules and the transporter associated with antigen processing (TAP), which is required for the transport of antigenic peptides across the endoplasmic reticulum membrane. This interaction is essential for optimal peptide loading on the MHC class I molecule. Up to four complexes of MHC class I and this protein may be bound to a single TAP molecule. This protein contains a C-terminal double-lysine motif (KKKAE) known to maintain membrane proteins in the endoplasmic reticulum. This gene lies within the major histocompatibility complex on chromosome 6. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced and thermolabile MHC class I surface expression due to impaired peptide loading with stabilizing peptides, impaired T cell selection, altered NK repertoire, lower CD8+ T cell numbers, and impaired responses to select class I-restricted antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd15 C T 11: 77,515,410 A71V probably damaging Het
Ager A G 17: 34,600,718 E357G probably damaging Het
Akap13 T C 7: 75,729,049 S2095P possibly damaging Het
Ampd2 T C 3: 108,080,337 probably null Het
Arrdc1 T C 2: 24,925,795 I398V probably benign Het
Ash1l T C 3: 89,052,065 Y2250H probably damaging Het
BC005561 T A 5: 104,518,257 I215N probably damaging Het
Brca2 G A 5: 150,552,258 A2478T probably damaging Het
Btrc T A 19: 45,513,382 probably benign Het
C8g C T 2: 25,500,216 A6T probably benign Het
Cdc123 T A 2: 5,803,977 probably null Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Cldn5 G A 16: 18,777,477 G161D probably damaging Het
Cndp2 G A 18: 84,677,315 probably benign Het
Cntnap1 C A 11: 101,180,360 F366L probably damaging Het
Corin C T 5: 72,302,790 probably null Het
Ctdspl2 G A 2: 122,003,929 R332K probably benign Het
Dido1 G A 2: 180,662,328 P1261L probably damaging Het
Dopey1 A T 9: 86,548,172 R2200* probably null Het
Dtx3l G A 16: 35,932,728 L503F probably damaging Het
Dysf A G 6: 84,067,047 K259R probably benign Het
Enpep T A 3: 129,319,448 T203S probably damaging Het
Epha2 T A 4: 141,322,047 probably null Het
Fam20b T C 1: 156,686,188 probably benign Het
Fbln7 A G 2: 128,877,429 T49A probably benign Het
Fgf14 T A 14: 124,676,539 K60M probably benign Het
Fhad1 T C 4: 141,985,511 I206V probably benign Het
Figla A G 6: 86,020,782 E164G probably benign Het
Gimap4 C A 6: 48,691,282 Q196K probably benign Het
Glcci1 C T 6: 8,537,964 T6I probably damaging Het
Gm6583 C T 5: 112,354,764 G358D probably benign Het
Grk4 T C 5: 34,694,750 S113P probably benign Het
Hectd3 G A 4: 116,996,566 E220K probably damaging Het
Hecw1 A G 13: 14,340,743 probably null Het
Helz2 G A 2: 181,236,297 P903S probably damaging Het
Hydin T C 8: 110,580,815 V3942A probably benign Het
Irs1 G T 1: 82,289,444 H350Q probably benign Het
Kdm1b G A 13: 47,064,054 E46K probably damaging Het
Klf11 A G 12: 24,655,305 N253D probably damaging Het
Klhl23 T C 2: 69,833,888 I527T probably damaging Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lcn4 G A 2: 26,668,576 P166L probably damaging Het
Letmd1 T A 15: 100,472,542 probably null Het
Lilra6 T A 7: 3,912,662 D358V probably damaging Het
Mmrn2 A G 14: 34,375,685 D24G probably benign Het
Mpp5 A G 12: 78,829,727 I482V probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mrps35 C T 6: 147,055,984 T169M probably damaging Het
Muc4 G A 16: 32,753,595 G1157D probably benign Het
Naga T A 15: 82,334,788 M237L probably null Het
Nfu1 G A 6: 87,020,809 E225K probably damaging Het
Nin A T 12: 70,042,669 L1324Q probably benign Het
Oc90 T A 15: 65,897,720 Y96F probably damaging Het
Olfr1029 T A 2: 85,975,995 F251I probably damaging Het
Olfr1253 C T 2: 89,752,267 C187Y probably damaging Het
Olfr1471 T C 19: 13,445,659 Y216H probably damaging Het
Olfr25 G A 9: 38,330,131 M181I possibly damaging Het
Olfr522 A G 7: 140,162,203 V249A probably damaging Het
Orc4 A T 2: 48,909,494 C324S possibly damaging Het
Pdzrn4 T C 15: 92,770,537 S857P probably benign Het
Plec C T 15: 76,185,908 E1000K possibly damaging Het
Plvap A T 8: 71,508,481 V149D probably benign Het
Pm20d2 A T 4: 33,174,772 N371K probably damaging Het
Ppp2r5d A G 17: 46,684,684 Y480H probably benign Het
Prkd1 A T 12: 50,425,515 V205E probably damaging Het
R3hdm2 A G 10: 127,476,690 I434V probably benign Het
Rel T A 11: 23,745,546 T246S probably damaging Het
Rnf215 T A 11: 4,136,719 V172E probably damaging Het
Scara3 T C 14: 65,921,104 D485G probably damaging Het
Sec16a A T 2: 26,431,157 Y1308N probably damaging Het
Sis A T 3: 72,932,060 D824E possibly damaging Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Srebf1 C T 11: 60,200,702 R999H probably benign Het
St3gal3 A C 4: 118,107,662 M1R probably null Het
Tep1 A T 14: 50,866,037 N265K probably damaging Het
Tln2 T A 9: 67,296,414 N470I probably damaging Het
Trim43a G T 9: 88,588,158 W339L probably damaging Het
Ttc22 T C 4: 106,622,780 F77S probably damaging Het
Ttc8 A G 12: 98,920,764 E32G probably benign Het
Uhmk1 A T 1: 170,208,653 probably null Het
Usp17lc A G 7: 103,418,941 H481R possibly damaging Het
Vamp8 G A 6: 72,385,634 T35M probably damaging Het
Vill A G 9: 119,065,586 Y53C probably damaging Het
Vmn1r222 A T 13: 23,232,762 S94T probably damaging Het
Vmn2r93 A G 17: 18,305,151 Y357C possibly damaging Het
Vps13c T A 9: 67,893,112 V536D possibly damaging Het
Vrtn G A 12: 84,650,081 C535Y probably damaging Het
Vwa3a A G 7: 120,768,165 Y181C probably damaging Het
Wfikkn2 G A 11: 94,238,895 T140I probably damaging Het
Ykt6 T A 11: 5,962,349 F101I probably damaging Het
Zfp277 C T 12: 40,378,826 G174D probably benign Het
Zfp638 A G 6: 83,978,065 probably null Het
Zzef1 C T 11: 72,924,679 P2942S probably damaging Het
Other mutations in Tapbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tapbp APN 17 33919892 missense probably benign
IGL00229:Tapbp APN 17 33925704 missense probably damaging 1.00
R0002:Tapbp UTSW 17 33925632 missense probably damaging 0.98
R0416:Tapbp UTSW 17 33925418 missense probably damaging 0.99
R0800:Tapbp UTSW 17 33926253 missense probably benign 0.39
R0839:Tapbp UTSW 17 33925743 missense probably benign 0.00
R1617:Tapbp UTSW 17 33920431 missense probably benign 0.06
R2214:Tapbp UTSW 17 33920326 missense possibly damaging 0.90
R3941:Tapbp UTSW 17 33920483 missense possibly damaging 0.91
R4570:Tapbp UTSW 17 33926453 missense probably damaging 1.00
R4571:Tapbp UTSW 17 33926453 missense probably damaging 1.00
R4935:Tapbp UTSW 17 33925622 missense probably benign 0.02
R6195:Tapbp UTSW 17 33919982 missense probably damaging 1.00
R6233:Tapbp UTSW 17 33919982 missense probably damaging 1.00
R6468:Tapbp UTSW 17 33926098 missense probably damaging 1.00
R6736:Tapbp UTSW 17 33919957 missense possibly damaging 0.85
R7139:Tapbp UTSW 17 33920048 missense possibly damaging 0.46
R7146:Tapbp UTSW 17 33925487 missense possibly damaging 0.93
R7233:Tapbp UTSW 17 33919969 missense probably damaging 0.99
R7448:Tapbp UTSW 17 33920417 missense possibly damaging 0.70
R7630:Tapbp UTSW 17 33920344 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAGAGATCGTAGCACCATGAAGCC -3'
(R):5'- TGGAAATGTGCTGACTACACACAGG -3'

Sequencing Primer
(F):5'- CTTGTTTAGGAATAGACACACTGGG -3'
(R):5'- TGAACGACTTAGAGAGCATCC -3'
Posted On2014-04-24