Incidental Mutation 'R1585:Sae1'
ID 177431
Institutional Source Beutler Lab
Gene Symbol Sae1
Ensembl Gene ENSMUSG00000052833
Gene Name SUMO1 activating enzyme subunit 1
Synonyms 2400010M20Rik, SUMO-1 activating enzyme subunit 1, HSPC140, AOS1, Uble1a, 2610044L12Rik, D7Ertd177e
MMRRC Submission 039622-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R1585 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 16054159-16121731 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 16064537 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094815] [ENSMUST00000210999] [ENSMUST00000211741]
AlphaFold Q9R1T2
Predicted Effect probably null
Transcript: ENSMUST00000094815
SMART Domains Protein: ENSMUSP00000092409
Gene: ENSMUSG00000052833

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:ThiF 23 344 4.3e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209749
Predicted Effect probably null
Transcript: ENSMUST00000210999
Predicted Effect probably null
Transcript: ENSMUST00000211741
Meta Mutation Damage Score 0.9595 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Posttranslational modification of proteins by the addition of the small protein SUMO (see SUMO1; MIM 601912), or sumoylation, regulates protein structure and intracellular localization. SAE1 and UBA2 (MIM 613295) form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et al., 1999 [PubMed 9920803]).[supplied by OMIM, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T A 10: 28,858,518 (GRCm39) I50F possibly damaging Het
4930505A04Rik T C 11: 30,377,175 (GRCm39) probably benign Het
Aadat A T 8: 60,979,714 (GRCm39) D192V possibly damaging Het
Akap12 A G 10: 4,303,640 (GRCm39) D150G probably benign Het
Amigo3 A T 9: 107,931,231 (GRCm39) N218I probably damaging Het
Ankmy1 A G 1: 92,827,373 (GRCm39) S60P probably benign Het
Apol7e G A 15: 77,602,029 (GRCm39) S209N probably damaging Het
AW551984 A T 9: 39,510,632 (GRCm39) Y234* probably null Het
Bcam A T 7: 19,494,111 (GRCm39) D393E probably damaging Het
Card9 A G 2: 26,244,398 (GRCm39) L444P probably benign Het
Ccar1 T C 10: 62,586,780 (GRCm39) E886G unknown Het
Ccnb2 A T 9: 70,317,559 (GRCm39) probably null Het
Cd276 T C 9: 58,442,838 (GRCm39) S206G probably damaging Het
Cds1 T A 5: 101,965,828 (GRCm39) probably benign Het
Cfap96 G A 8: 46,409,515 (GRCm39) S268L probably benign Het
Chuk T C 19: 44,065,812 (GRCm39) S661G possibly damaging Het
Col17a1 T C 19: 47,639,276 (GRCm39) N1090D probably benign Het
Col3a1 A T 1: 45,367,026 (GRCm39) probably null Het
Crispld1 G T 1: 17,821,024 (GRCm39) V355F possibly damaging Het
Cspg4 A T 9: 56,806,151 (GRCm39) R2321W probably damaging Het
Dner T C 1: 84,563,177 (GRCm39) T61A probably benign Het
Dnmt3a A T 12: 3,951,660 (GRCm39) Y679F probably damaging Het
Dzip3 A T 16: 48,798,241 (GRCm39) probably benign Het
Eif3l T C 15: 78,968,381 (GRCm39) S217P possibly damaging Het
Fbxo42 T A 4: 140,925,417 (GRCm39) probably benign Het
Fhod1 A T 8: 106,063,957 (GRCm39) probably benign Het
Fzd1 T A 5: 4,806,278 (GRCm39) I435F probably damaging Het
Gapvd1 C T 2: 34,602,207 (GRCm39) V647I possibly damaging Het
Gm14496 T C 2: 181,638,002 (GRCm39) S359P possibly damaging Het
Gm5218 C A 15: 81,383,741 (GRCm39) noncoding transcript Het
Hnrnph3 A G 10: 62,851,579 (GRCm39) probably null Het
Hsd17b12 G T 2: 93,864,321 (GRCm39) T262K probably damaging Het
Igsf10 G C 3: 59,237,838 (GRCm39) P781R probably damaging Het
Il11ra1 T A 4: 41,768,207 (GRCm39) S373T probably damaging Het
Kdm3b A G 18: 34,942,345 (GRCm39) D612G probably damaging Het
Ldb1 T C 19: 46,022,903 (GRCm39) T261A probably damaging Het
Lep C A 6: 29,069,089 (GRCm39) H47N possibly damaging Het
Lrrtm2 A T 18: 35,346,428 (GRCm39) S291R possibly damaging Het
Ncor2 T C 5: 125,162,062 (GRCm39) Q404R unknown Het
Nlrp4d T C 7: 10,116,437 (GRCm39) H148R probably benign Het
Nlrp9a T A 7: 26,258,093 (GRCm39) D570E probably benign Het
Nphp3 G A 9: 103,886,413 (GRCm39) V202I probably damaging Het
Nptn T A 9: 58,548,073 (GRCm39) N159K probably benign Het
Or4a69 T A 2: 89,313,315 (GRCm39) T55S probably benign Het
Or4a72 A T 2: 89,405,746 (GRCm39) V108D possibly damaging Het
Or51f2 G A 7: 102,526,980 (GRCm39) V218I probably benign Het
Or52a24 A T 7: 103,381,585 (GRCm39) T151S possibly damaging Het
Or8b53 A T 9: 38,667,716 (GRCm39) H244L probably damaging Het
Pcolce T A 5: 137,608,769 (GRCm39) R13* probably null Het
Pdgfra A G 5: 75,353,264 (GRCm39) Y1018C probably damaging Het
Prima1 A G 12: 103,201,854 (GRCm39) S74P probably damaging Het
Prl7c1 A G 13: 27,962,838 (GRCm39) L55P probably damaging Het
Rasef A G 4: 73,658,574 (GRCm39) V513A probably damaging Het
Rgs1 T C 1: 144,121,227 (GRCm39) probably null Het
Rlf T C 4: 121,005,488 (GRCm39) E1164G probably benign Het
Rnf213 A T 11: 119,354,171 (GRCm39) N4016I probably damaging Het
Serping1 A T 2: 84,601,848 (GRCm39) D207E probably benign Het
Setd2 T A 9: 110,380,464 (GRCm39) D33E unknown Het
Simc1 T C 13: 54,673,071 (GRCm39) M473T probably benign Het
Slc30a6 T A 17: 74,725,610 (GRCm39) probably benign Het
Slc4a5 T C 6: 83,242,669 (GRCm39) L346P probably damaging Het
Spef2 T A 15: 9,596,660 (GRCm39) Q1473L probably damaging Het
St3gal3 G T 4: 117,817,204 (GRCm39) A44D possibly damaging Het
Sv2b G T 7: 74,797,425 (GRCm39) T323K probably damaging Het
Sycp2 T A 2: 177,993,461 (GRCm39) N1228I possibly damaging Het
Thbs2 T A 17: 14,910,030 (GRCm39) M190L probably benign Het
Tnrc6a G A 7: 122,776,098 (GRCm39) V1190I probably benign Het
Utrn A T 10: 12,312,029 (GRCm39) I673K possibly damaging Het
Vmn2r114 C T 17: 23,510,675 (GRCm39) V602M probably damaging Het
Wdr7 A T 18: 64,057,989 (GRCm39) I1273L probably benign Het
Zfp618 T C 4: 63,051,175 (GRCm39) L652P probably damaging Het
Zfp804a G A 2: 81,884,095 (GRCm39) probably benign Het
Other mutations in Sae1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Sae1 APN 7 16,064,581 (GRCm39) missense possibly damaging 0.94
IGL02672:Sae1 APN 7 16,104,273 (GRCm39) missense probably damaging 1.00
IGL02881:Sae1 APN 7 16,093,043 (GRCm39) missense probably damaging 1.00
R0255:Sae1 UTSW 7 16,104,247 (GRCm39) nonsense probably null
R0667:Sae1 UTSW 7 16,102,457 (GRCm39) missense probably damaging 1.00
R1374:Sae1 UTSW 7 16,112,333 (GRCm39) missense probably damaging 0.97
R1960:Sae1 UTSW 7 16,102,490 (GRCm39) missense possibly damaging 0.90
R2278:Sae1 UTSW 7 16,104,291 (GRCm39) missense probably damaging 1.00
R5513:Sae1 UTSW 7 16,100,781 (GRCm39) missense probably benign 0.00
R5677:Sae1 UTSW 7 16,104,387 (GRCm39) critical splice acceptor site probably null
R6694:Sae1 UTSW 7 16,102,461 (GRCm39) missense probably damaging 1.00
R6975:Sae1 UTSW 7 16,070,712 (GRCm39) missense probably damaging 0.99
R7307:Sae1 UTSW 7 16,102,469 (GRCm39) nonsense probably null
R7914:Sae1 UTSW 7 16,121,648 (GRCm39) missense unknown
R8437:Sae1 UTSW 7 16,104,279 (GRCm39) missense probably damaging 1.00
R9076:Sae1 UTSW 7 16,070,668 (GRCm39) missense probably benign
Z1177:Sae1 UTSW 7 16,061,796 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAACCTGCTCACACGACTG -3'
(R):5'- AGGTCTTCCCCACCCACTTAAGAG -3'

Sequencing Primer
(F):5'- TGCTCACACGACTGGTAGAG -3'
(R):5'- TGGATACCAGCTCTAGCACTG -3'
Posted On 2014-04-24