Incidental Mutation 'R1586:Rpl7'
ID177481
Institutional Source Beutler Lab
Gene Symbol Rpl7
Ensembl Gene ENSMUSG00000043716
Gene Nameribosomal protein L7
SynonymsSurf-3, Rpl7a
MMRRC Submission 039623-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R1586 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location16101295-16104662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16102583 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 171 (S171T)
Ref Sequence ENSEMBL: ENSMUSP00000071616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027053] [ENSMUST00000058437]
Predicted Effect probably benign
Transcript: ENSMUST00000027053
SMART Domains Protein: ENSMUSP00000027053
Gene: ENSMUSG00000025921

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:KR 37 231 3.1e-8 PFAM
Pfam:adh_short 90 259 1.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058437
AA Change: S171T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000071616
Gene: ENSMUSG00000043716
AA Change: S171T

DomainStartEndE-ValueType
Pfam:Ribosomal_L30_N 39 109 4.5e-31 PFAM
Pfam:Ribosomal_L30 112 162 1.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141217
Predicted Effect unknown
Transcript: ENSMUST00000149566
AA Change: S196T
SMART Domains Protein: ENSMUSP00000118695
Gene: ENSMUSG00000043716
AA Change: S196T

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
Pfam:Ribosomal_L30_N 65 135 2.1e-31 PFAM
Pfam:Ribosomal_L30 138 188 3e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151017
Meta Mutation Damage Score 0.0631 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 93% (65/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L30P family of ribosomal proteins. It contains an N-terminal basic region-leucine zipper (BZIP)-like domain and the RNP consensus submotif RNP2. In vitro the BZIP-like domain mediates homodimerization and stable binding to DNA and RNA, with a preference for 28S rRNA and mRNA. The protein can inhibit cell-free translation of mRNAs, suggesting that it plays a regulatory role in the translation apparatus. It is located in the cytoplasm. The protein has been shown to be an autoantigen in patients with systemic autoimmune diseases, such as systemic lupus erythematosus. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,512 I282V probably benign Het
9030624J02Rik T A 7: 118,809,972 I612N probably damaging Het
Abca2 C T 2: 25,447,216 A2361V probably damaging Het
Alpi A G 1: 87,100,201 I219T probably damaging Het
Anapc10 T A 8: 79,775,143 M180K probably benign Het
Ank3 A G 10: 69,877,878 I431V probably damaging Het
Anxa8 T A 14: 34,093,937 D182E probably damaging Het
Atp1a3 T A 7: 24,979,383 I945F probably damaging Het
Atp2a3 T C 11: 72,991,744 S1019P probably damaging Het
Cbs T A 17: 31,622,474 I258F probably damaging Het
Cic T C 7: 25,285,961 S277P probably damaging Het
Cidea T A 18: 67,360,160 V83E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca3a2 A G 3: 144,810,716 I373T possibly damaging Het
Cpvl T A 6: 53,926,901 D293V probably damaging Het
Cryz A G 3: 154,611,510 N122S probably benign Het
Dmap1 T C 4: 117,676,122 E245G probably damaging Het
Epha2 C T 4: 141,318,605 probably benign Het
Fam222b C T 11: 78,154,521 L303F probably damaging Het
Fastkd1 T C 2: 69,712,148 D105G probably benign Het
Fat4 T A 3: 38,888,860 L634Q probably damaging Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fig4 A G 10: 41,265,427 F279L probably damaging Het
Guk1 A G 11: 59,186,849 S22P probably damaging Het
Kmt2d A G 15: 98,865,053 probably benign Het
Macf1 A T 4: 123,509,846 S727T probably benign Het
Mgea5 T G 19: 45,776,910 T153P possibly damaging Het
Mki67 T A 7: 135,713,972 K54* probably null Het
Ms4a8a T C 19: 11,076,332 T137A possibly damaging Het
Myo5c T C 9: 75,267,031 Y557H probably damaging Het
Nav3 T A 10: 109,853,254 K387N probably damaging Het
Olfr1432 G T 19: 12,228,877 A223E probably damaging Het
Pde4c T A 8: 70,746,859 Y223N probably damaging Het
Psd T G 19: 46,314,798 E715A probably damaging Het
Rrm1 A G 7: 102,466,905 *66W probably null Het
Scgb1b3 T A 7: 31,375,963 H79Q probably damaging Het
Serpinb9 A T 13: 33,015,486 M255L probably benign Het
Slc35a4 T C 18: 36,683,005 V296A probably benign Het
Smgc G A 15: 91,838,393 A9T possibly damaging Het
Snx11 C A 11: 96,770,696 W161L probably benign Het
Spag17 A G 3: 100,021,752 K533E possibly damaging Het
Speer4b A G 5: 27,497,013 S250P probably damaging Het
Spta1 A T 1: 174,213,495 H1287L probably benign Het
Surf2 T C 2: 26,919,755 F239S probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tbc1d22a C A 15: 86,351,651 probably null Het
Tbcd A G 11: 121,497,060 Q339R probably benign Het
Tdrd7 A G 4: 45,994,445 H281R probably benign Het
Tomm5 A G 4: 45,107,915 probably null Het
Ttc7 T C 17: 87,361,945 probably null Het
Ulk1 A T 5: 110,789,516 F638Y probably damaging Het
Wdr93 C A 7: 79,768,361 D277E probably damaging Het
Znrf3 T C 11: 5,281,477 R583G probably damaging Het
Zscan29 T A 2: 121,161,160 I716F probably damaging Het
Other mutations in Rpl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Rpl7 APN 1 16102583 missense possibly damaging 0.48
R0241:Rpl7 UTSW 1 16103222 missense possibly damaging 0.57
R1033:Rpl7 UTSW 1 16102504 missense probably benign 0.36
R1447:Rpl7 UTSW 1 16102597 missense probably benign 0.01
R4809:Rpl7 UTSW 1 16101965 intron probably benign
R6511:Rpl7 UTSW 1 16103665 missense probably benign 0.00
R8000:Rpl7 UTSW 1 16102725 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GGAAGACACATGACATTTGGGCCAC -3'
(R):5'- TCTTCGACAGATCTTCAATGGCACC -3'

Sequencing Primer
(F):5'- CACCCACACGTATACaaaataaaag -3'
(R):5'- ATGGCACCTTTGTTAAGCTCAAC -3'
Posted On2014-04-24