Incidental Mutation 'R1586:Cryz'
ID177492
Institutional Source Beutler Lab
Gene Symbol Cryz
Ensembl Gene ENSMUSG00000028199
Gene Namecrystallin, zeta
SynonymsSez9, quinone reductase, SEZ9
MMRRC Submission 039623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R1586 (G1)
Quality Score153
Status Validated
Chromosome3
Chromosomal Location154596711-154623182 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154611510 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 122 (N122S)
Ref Sequence ENSEMBL: ENSMUSP00000142101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029850] [ENSMUST00000135723] [ENSMUST00000140644] [ENSMUST00000144764] [ENSMUST00000155232] [ENSMUST00000155385] [ENSMUST00000184537] [ENSMUST00000192462] [ENSMUST00000194876]
Predicted Effect probably benign
Transcript: ENSMUST00000029850
AA Change: N122S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029850
Gene: ENSMUSG00000028199
AA Change: N122S

DomainStartEndE-ValueType
Pfam:ADH_N 35 131 3.3e-14 PFAM
Pfam:ADH_zinc_N 160 290 1.3e-30 PFAM
Pfam:ADH_zinc_N_2 192 329 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135723
SMART Domains Protein: ENSMUSP00000143311
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
PDB:1YB5|B 1 38 5e-17 PDB
SCOP:d1qora1 9 38 9e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140644
SMART Domains Protein: ENSMUSP00000115146
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 98 1.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144764
AA Change: N122S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121269
Gene: ENSMUSG00000028199
AA Change: N122S

DomainStartEndE-ValueType
Pfam:ADH_N 35 132 2.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155232
AA Change: N122S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118449
Gene: ENSMUSG00000028199
AA Change: N122S

DomainStartEndE-ValueType
Pfam:ADH_N 35 135 3.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155385
AA Change: N122S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122619
Gene: ENSMUSG00000028199
AA Change: N122S

DomainStartEndE-ValueType
Pfam:ADH_N 35 130 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184537
AA Change: N122S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139387
Gene: ENSMUSG00000028199
AA Change: N122S

DomainStartEndE-ValueType
Pfam:ADH_N 35 180 4.7e-17 PFAM
Pfam:ADH_zinc_N 160 218 5.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192462
AA Change: N122S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142105
Gene: ENSMUSG00000028199
AA Change: N122S

DomainStartEndE-ValueType
Pfam:ADH_N 35 131 2.8e-16 PFAM
Pfam:ADH_zinc_N 160 290 1.8e-29 PFAM
Pfam:ADH_zinc_N_2 192 329 4.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194876
AA Change: N122S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142101
Gene: ENSMUSG00000028199
AA Change: N122S

DomainStartEndE-ValueType
Pfam:ADH_N 35 139 2.2e-14 PFAM
Pfam:ADH_zinc_N 160 290 1.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195292
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 93% (65/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. The former class is also called phylogenetically-restricted crystallins. This gene encodes a taxon-specific crystallin protein which has NADPH-dependent quinone reductase activity distinct from other known quinone reductases. It lacks alcohol dehydrogenase activity although by similarity it is considered a member of the zinc-containing alcohol dehydrogenase family. Unlike other mammalian species, in humans, lens expression is low. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. One pseudogene is known to exist. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,512 I282V probably benign Het
9030624J02Rik T A 7: 118,809,972 I612N probably damaging Het
Abca2 C T 2: 25,447,216 A2361V probably damaging Het
Alpi A G 1: 87,100,201 I219T probably damaging Het
Anapc10 T A 8: 79,775,143 M180K probably benign Het
Ank3 A G 10: 69,877,878 I431V probably damaging Het
Anxa8 T A 14: 34,093,937 D182E probably damaging Het
Atp1a3 T A 7: 24,979,383 I945F probably damaging Het
Atp2a3 T C 11: 72,991,744 S1019P probably damaging Het
Cbs T A 17: 31,622,474 I258F probably damaging Het
Cic T C 7: 25,285,961 S277P probably damaging Het
Cidea T A 18: 67,360,160 V83E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca3a2 A G 3: 144,810,716 I373T possibly damaging Het
Cpvl T A 6: 53,926,901 D293V probably damaging Het
Dmap1 T C 4: 117,676,122 E245G probably damaging Het
Epha2 C T 4: 141,318,605 probably benign Het
Fam222b C T 11: 78,154,521 L303F probably damaging Het
Fastkd1 T C 2: 69,712,148 D105G probably benign Het
Fat4 T A 3: 38,888,860 L634Q probably damaging Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fig4 A G 10: 41,265,427 F279L probably damaging Het
Guk1 A G 11: 59,186,849 S22P probably damaging Het
Kmt2d A G 15: 98,865,053 probably benign Het
Macf1 A T 4: 123,509,846 S727T probably benign Het
Mgea5 T G 19: 45,776,910 T153P possibly damaging Het
Mki67 T A 7: 135,713,972 K54* probably null Het
Ms4a8a T C 19: 11,076,332 T137A possibly damaging Het
Myo5c T C 9: 75,267,031 Y557H probably damaging Het
Nav3 T A 10: 109,853,254 K387N probably damaging Het
Olfr1432 G T 19: 12,228,877 A223E probably damaging Het
Pde4c T A 8: 70,746,859 Y223N probably damaging Het
Psd T G 19: 46,314,798 E715A probably damaging Het
Rpl7 A T 1: 16,102,583 S171T probably benign Het
Rrm1 A G 7: 102,466,905 *66W probably null Het
Scgb1b3 T A 7: 31,375,963 H79Q probably damaging Het
Serpinb9 A T 13: 33,015,486 M255L probably benign Het
Slc35a4 T C 18: 36,683,005 V296A probably benign Het
Smgc G A 15: 91,838,393 A9T possibly damaging Het
Snx11 C A 11: 96,770,696 W161L probably benign Het
Spag17 A G 3: 100,021,752 K533E possibly damaging Het
Speer4b A G 5: 27,497,013 S250P probably damaging Het
Spta1 A T 1: 174,213,495 H1287L probably benign Het
Surf2 T C 2: 26,919,755 F239S probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tbc1d22a C A 15: 86,351,651 probably null Het
Tbcd A G 11: 121,497,060 Q339R probably benign Het
Tdrd7 A G 4: 45,994,445 H281R probably benign Het
Tomm5 A G 4: 45,107,915 probably null Het
Ttc7 T C 17: 87,361,945 probably null Het
Ulk1 A T 5: 110,789,516 F638Y probably damaging Het
Wdr93 C A 7: 79,768,361 D277E probably damaging Het
Znrf3 T C 11: 5,281,477 R583G probably damaging Het
Zscan29 T A 2: 121,161,160 I716F probably damaging Het
Other mutations in Cryz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Cryz APN 3 154604942 missense possibly damaging 0.95
IGL00838:Cryz APN 3 154618475 missense probably damaging 1.00
IGL00969:Cryz APN 3 154618526 nonsense probably null
IGL01571:Cryz APN 3 154621743 missense probably damaging 1.00
IGL03082:Cryz APN 3 154604926 missense probably damaging 1.00
R0049:Cryz UTSW 3 154611552 missense probably damaging 1.00
R0049:Cryz UTSW 3 154611552 missense probably damaging 1.00
R1116:Cryz UTSW 3 154621603 splice site probably benign
R1470:Cryz UTSW 3 154606476 missense probably damaging 1.00
R1470:Cryz UTSW 3 154606476 missense probably damaging 1.00
R2018:Cryz UTSW 3 154621683 missense probably damaging 1.00
R2223:Cryz UTSW 3 154618554 missense possibly damaging 0.86
R2334:Cryz UTSW 3 154622191 missense probably benign 0.04
R4488:Cryz UTSW 3 154618457 splice site probably benign
R5547:Cryz UTSW 3 154611557 nonsense probably null
R5595:Cryz UTSW 3 154606518 missense probably damaging 1.00
R5917:Cryz UTSW 3 154621766 missense probably benign 0.05
R7197:Cryz UTSW 3 154621568 missense probably damaging 0.99
R7473:Cryz UTSW 3 154606520 missense probably benign
R8121:Cryz UTSW 3 154621745 missense probably benign 0.00
Z1176:Cryz UTSW 3 154621769 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATGTGGAAGAGCACAGCACTGAGC -3'
(R):5'- CTGTGATTGGCATGACCCCAAAATG -3'

Sequencing Primer
(F):5'- ACCTGCATAGAGATTCGCTG -3'
(R):5'- GCATGACCCCAAAATGCTTAATC -3'
Posted On2014-04-24