Incidental Mutation 'R1586:Fbxo10'
ID177494
Institutional Source Beutler Lab
Gene Symbol Fbxo10
Ensembl Gene ENSMUSG00000048232
Gene NameF-box protein 10
SynonymsFBX10, LOC269529
MMRRC Submission 039623-MU
Accession Numbers

Genbank: NM_001024142; MGI: 2686937  

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1586 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location45034247-45084604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45042036 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 731 (I731N)
Ref Sequence ENSEMBL: ENSMUSP00000058233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052236]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052236
AA Change: I731N

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058233
Gene: ENSMUSG00000048232
AA Change: I731N

DomainStartEndE-ValueType
FBOX 6 48 1.92e-6 SMART
PbH1 198 217 8.34e3 SMART
PbH1 238 260 1.37e3 SMART
CASH 337 511 7.29e-6 SMART
PbH1 423 444 1.41e2 SMART
PbH1 467 489 1.33e3 SMART
PbH1 490 512 1.32e2 SMART
PbH1 513 535 8.34e3 SMART
PbH1 536 558 2.87e1 SMART
CASH 536 672 5.49e1 SMART
PbH1 559 581 1.25e1 SMART
PbH1 582 604 2.64e2 SMART
PbH1 605 627 6.05e3 SMART
PbH1 628 650 2.46e2 SMART
PbH1 651 673 2.14e2 SMART
CASH 681 804 6.58e1 SMART
PbH1 713 735 6.52e2 SMART
PbH1 736 758 5.92e2 SMART
PbH1 760 782 1.13e3 SMART
PbH1 783 805 1.86e2 SMART
PbH1 828 850 9.32e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000140008
AA Change: I557N
SMART Domains Protein: ENSMUSP00000119862
Gene: ENSMUSG00000048232
AA Change: I557N

DomainStartEndE-ValueType
PbH1 25 44 8.34e3 SMART
PbH1 65 87 1.37e3 SMART
CASH 164 338 7.29e-6 SMART
PbH1 250 271 1.41e2 SMART
PbH1 294 316 1.33e3 SMART
PbH1 317 339 1.32e2 SMART
PbH1 340 362 8.34e3 SMART
PbH1 363 385 2.87e1 SMART
CASH 363 499 5.49e1 SMART
PbH1 386 408 1.25e1 SMART
PbH1 409 431 2.64e2 SMART
PbH1 432 454 6.05e3 SMART
PbH1 455 477 2.46e2 SMART
PbH1 478 500 2.14e2 SMART
CASH 508 631 6.58e1 SMART
PbH1 540 562 6.52e2 SMART
PbH1 563 585 5.92e2 SMART
PbH1 587 609 1.13e3 SMART
PbH1 610 632 1.86e2 SMART
PbH1 655 677 9.32e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155583
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 93% (65/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO10, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,512 I282V probably benign Het
9030624J02Rik T A 7: 118,809,972 I612N probably damaging Het
Abca2 C T 2: 25,447,216 A2361V probably damaging Het
Alpi A G 1: 87,100,201 I219T probably damaging Het
Anapc10 T A 8: 79,775,143 M180K probably benign Het
Ank3 A G 10: 69,877,878 I431V probably damaging Het
Anxa8 T A 14: 34,093,937 D182E probably damaging Het
Atp1a3 T A 7: 24,979,383 I945F probably damaging Het
Atp2a3 T C 11: 72,991,744 S1019P probably damaging Het
Cbs T A 17: 31,622,474 I258F probably damaging Het
Cic T C 7: 25,285,961 S277P probably damaging Het
Cidea T A 18: 67,360,160 V83E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca3a2 A G 3: 144,810,716 I373T possibly damaging Het
Cpvl T A 6: 53,926,901 D293V probably damaging Het
Cryz A G 3: 154,611,510 N122S probably benign Het
Dmap1 T C 4: 117,676,122 E245G probably damaging Het
Epha2 C T 4: 141,318,605 probably benign Het
Fam222b C T 11: 78,154,521 L303F probably damaging Het
Fastkd1 T C 2: 69,712,148 D105G probably benign Het
Fat4 T A 3: 38,888,860 L634Q probably damaging Het
Fig4 A G 10: 41,265,427 F279L probably damaging Het
Guk1 A G 11: 59,186,849 S22P probably damaging Het
Kmt2d A G 15: 98,865,053 probably benign Het
Macf1 A T 4: 123,509,846 S727T probably benign Het
Mgea5 T G 19: 45,776,910 T153P possibly damaging Het
Mki67 T A 7: 135,713,972 K54* probably null Het
Ms4a8a T C 19: 11,076,332 T137A possibly damaging Het
Myo5c T C 9: 75,267,031 Y557H probably damaging Het
Nav3 T A 10: 109,853,254 K387N probably damaging Het
Olfr1432 G T 19: 12,228,877 A223E probably damaging Het
Pde4c T A 8: 70,746,859 Y223N probably damaging Het
Psd T G 19: 46,314,798 E715A probably damaging Het
Rpl7 A T 1: 16,102,583 S171T probably benign Het
Rrm1 A G 7: 102,466,905 *66W probably null Het
Scgb1b3 T A 7: 31,375,963 H79Q probably damaging Het
Serpinb9 A T 13: 33,015,486 M255L probably benign Het
Slc35a4 T C 18: 36,683,005 V296A probably benign Het
Smgc G A 15: 91,838,393 A9T possibly damaging Het
Snx11 C A 11: 96,770,696 W161L probably benign Het
Spag17 A G 3: 100,021,752 K533E possibly damaging Het
Speer4b A G 5: 27,497,013 S250P probably damaging Het
Spta1 A T 1: 174,213,495 H1287L probably benign Het
Surf2 T C 2: 26,919,755 F239S probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tbc1d22a C A 15: 86,351,651 probably null Het
Tbcd A G 11: 121,497,060 Q339R probably benign Het
Tdrd7 A G 4: 45,994,445 H281R probably benign Het
Tomm5 A G 4: 45,107,915 probably null Het
Ttc7 T C 17: 87,361,945 probably null Het
Ulk1 A T 5: 110,789,516 F638Y probably damaging Het
Wdr93 C A 7: 79,768,361 D277E probably damaging Het
Znrf3 T C 11: 5,281,477 R583G probably damaging Het
Zscan29 T A 2: 121,161,160 I716F probably damaging Het
Other mutations in Fbxo10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Fbxo10 APN 4 45058684 missense probably damaging 0.98
IGL02073:Fbxo10 APN 4 45046349 missense possibly damaging 0.94
IGL02097:Fbxo10 APN 4 45048527 missense probably benign 0.24
IGL02315:Fbxo10 APN 4 45062469 missense probably benign 0.08
IGL02403:Fbxo10 APN 4 45062517 missense probably benign 0.01
IGL02408:Fbxo10 APN 4 45058361 missense possibly damaging 0.75
IGL02496:Fbxo10 APN 4 45043883 missense probably damaging 1.00
IGL02583:Fbxo10 APN 4 45044754 missense probably damaging 1.00
IGL02794:Fbxo10 APN 4 45041928 missense probably benign 0.20
N/A - 287:Fbxo10 UTSW 4 45044708 splice site probably benign
R1033:Fbxo10 UTSW 4 45062236 missense probably damaging 1.00
R1102:Fbxo10 UTSW 4 45043672 missense probably damaging 1.00
R1583:Fbxo10 UTSW 4 45062118 missense probably damaging 1.00
R1789:Fbxo10 UTSW 4 45046389 missense probably damaging 1.00
R2187:Fbxo10 UTSW 4 45058531 missense probably benign 0.09
R2191:Fbxo10 UTSW 4 45044811 missense probably damaging 1.00
R2377:Fbxo10 UTSW 4 45044719 missense probably benign 0.18
R2425:Fbxo10 UTSW 4 45051642 missense possibly damaging 0.60
R2495:Fbxo10 UTSW 4 45040545 missense probably benign 0.00
R4105:Fbxo10 UTSW 4 45059054 missense probably benign 0.01
R4472:Fbxo10 UTSW 4 45043693 missense probably damaging 1.00
R4480:Fbxo10 UTSW 4 45048470 missense probably damaging 1.00
R4985:Fbxo10 UTSW 4 45040692 missense probably benign 0.33
R5193:Fbxo10 UTSW 4 45051573 nonsense probably null
R5309:Fbxo10 UTSW 4 45042036 missense possibly damaging 0.82
R5312:Fbxo10 UTSW 4 45042036 missense possibly damaging 0.82
R5348:Fbxo10 UTSW 4 45058934 missense probably damaging 1.00
R5694:Fbxo10 UTSW 4 45035970 missense probably damaging 1.00
R5844:Fbxo10 UTSW 4 45058760 missense probably benign 0.09
R5974:Fbxo10 UTSW 4 45040631 missense probably benign 0.18
R5990:Fbxo10 UTSW 4 45061960 missense probably damaging 1.00
R6197:Fbxo10 UTSW 4 45043857 missense probably benign 0.03
R6359:Fbxo10 UTSW 4 45041796 missense possibly damaging 0.93
R6808:Fbxo10 UTSW 4 45059035 missense probably benign 0.00
R6873:Fbxo10 UTSW 4 45041787 missense possibly damaging 0.94
R6921:Fbxo10 UTSW 4 45044849 missense probably damaging 1.00
R7089:Fbxo10 UTSW 4 45062230 missense possibly damaging 0.90
R7120:Fbxo10 UTSW 4 45040533 nonsense probably null
R7498:Fbxo10 UTSW 4 45062194 missense probably benign 0.04
R7872:Fbxo10 UTSW 4 45051699 missense not run
R8022:Fbxo10 UTSW 4 45062062 missense possibly damaging 0.93
R8161:Fbxo10 UTSW 4 45044793 missense probably damaging 1.00
R8416:Fbxo10 UTSW 4 45058942 missense possibly damaging 0.83
R8419:Fbxo10 UTSW 4 45041809 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGCACTGAAATTCCACCTTGACCC -3'
(R):5'- TTCACGCTGTTGCTCCCAGAAC -3'

Sequencing Primer
(F):5'- TTGACCCCACTCTGGCG -3'
(R):5'- CTCTCCTGCCATTGAATAGGATGAG -3'
Posted On2014-04-24