Mutagenetix > Incidental Mutation

Incidental Mutation 'R1586:Dmap1'

177497

Institutional Source

Beutler Lab

Gene Symbol

Dmap1

Ensembl Gene

ENSMUSG00000009640

Gene Name

DNA methyltransferase 1-associated protein 1

Synonyms

1500016M21Rik

MMRRC Submission

039623-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1586 (G1)

Quality Score

175

Status

Validated

Chromosome

Chromosomal Location

117531878-117539450 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 117533319 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 245 (E245G)

Ref Sequence

ENSEMBL: ENSMUSP00000099748 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037127] [ENSMUST00000102687]

AlphaFold

Q9JI44

Predicted Effect

probably benign
Transcript: ENSMUST00000037127

SMART Domains

Protein: ENSMUSP00000042796
Gene: ENSMUSG00000033423

Domain	Start	End	E-Value	Type
low complexity region	23	35	N/A	INTRINSIC
low complexity region	124	135	N/A	INTRINSIC
EXOIII	145	329	1.17e-42	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102687
AA Change: E245G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099748
Gene: ENSMUSG00000009640
AA Change: E245G

Domain	Start	End	E-Value	Type
low complexity region	25	42	N/A	INTRINSIC
SANT	148	201	3.38e-2	SMART
Pfam:DMAP1	243	404	7.1e-76	PFAM
low complexity region	449	467	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123586

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129510

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134379

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135582

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146384

Meta Mutation Damage Score

0.7464

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.2%
20x: 88.8%

Validation Efficiency

93% (65/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of several, distinct complexes involved in the repression or activation of transcription. The encoded protein can independently repress transcription and is targeted to replication foci throughout S phase by interacting directly with the N-terminus of DNA methyltransferase 1. During late S phase, histone deacetylase 2 is added to this complex, providing a means to deacetylate histones in transcriptionally inactive heterochromatin following replication. The encoded protein is also a component of the nucleosome acetyltransferase of H4 complex and interacts with the transcriptional corepressor tumor susceptibility gene 101 and the pro-apoptotic death-associated protein 6, among others. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die prior to implantation with no 8-cell embryos detected. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	C	T	2: 25,337,228 (GRCm39)	A2361V	probably damaging	Het
Alpi	A	G	1: 87,027,923 (GRCm39)	I219T	probably damaging	Het
Anapc10	T	A	8: 80,501,772 (GRCm39)	M180K	probably benign	Het
Ank3	A	G	10: 69,713,708 (GRCm39)	I431V	probably damaging	Het
Anxa8	T	A	14: 33,815,894 (GRCm39)	D182E	probably damaging	Het
Atp1a3	T	A	7: 24,678,808 (GRCm39)	I945F	probably damaging	Het
Atp2a3	T	C	11: 72,882,570 (GRCm39)	S1019P	probably damaging	Het
Cbs	T	A	17: 31,841,448 (GRCm39)	I258F	probably damaging	Het
Cic	T	C	7: 24,985,386 (GRCm39)	S277P	probably damaging	Het
Cidea	T	A	18: 67,493,230 (GRCm39)	V83E	probably damaging	Het
Cilp	G	A	9: 65,186,997 (GRCm39)	G1031S	probably damaging	Het
Clca3a2	A	G	3: 144,516,477 (GRCm39)	I373T	possibly damaging	Het
Cpvl	T	A	6: 53,903,886 (GRCm39)	D293V	probably damaging	Het
Cryz	A	G	3: 154,317,147 (GRCm39)	N122S	probably benign	Het
Epha2	C	T	4: 141,045,916 (GRCm39)		probably benign	Het
Fam222b	C	T	11: 78,045,347 (GRCm39)	L303F	probably damaging	Het
Fastkd1	T	C	2: 69,542,492 (GRCm39)	D105G	probably benign	Het
Fat4	T	A	3: 38,943,009 (GRCm39)	L634Q	probably damaging	Het
Fbxo10	A	T	4: 45,042,036 (GRCm39)	I731N	possibly damaging	Het
Fig4	A	G	10: 41,141,423 (GRCm39)	F279L	probably damaging	Het
Guk1	A	G	11: 59,077,675 (GRCm39)	S22P	probably damaging	Het
Kmt2d	A	G	15: 98,762,934 (GRCm39)		probably benign	Het
Macf1	A	T	4: 123,403,639 (GRCm39)	S727T	probably benign	Het
Mki67	T	A	7: 135,315,701 (GRCm39)	K54*	probably null	Het
Ms4a8a	T	C	19: 11,053,696 (GRCm39)	T137A	possibly damaging	Het
Myo5c	T	C	9: 75,174,313 (GRCm39)	Y557H	probably damaging	Het
Nav3	T	A	10: 109,689,115 (GRCm39)	K387N	probably damaging	Het
Oga	T	G	19: 45,765,349 (GRCm39)	T153P	possibly damaging	Het
Or5bb10	G	T	19: 12,206,241 (GRCm39)	A223E	probably damaging	Het
Pde4c	T	A	8: 71,199,508 (GRCm39)	Y223N	probably damaging	Het
Psd	T	G	19: 46,303,237 (GRCm39)	E715A	probably damaging	Het
Rpl7	A	T	1: 16,172,807 (GRCm39)	S171T	probably benign	Het
Rrm1	A	G	7: 102,116,112 (GRCm39)	*66W	probably null	Het
Scgb1b3	T	A	7: 31,075,388 (GRCm39)	H79Q	probably damaging	Het
Serpinb9	A	T	13: 33,199,469 (GRCm39)	M255L	probably benign	Het
Slc35a4	T	C	18: 36,816,058 (GRCm39)	V296A	probably benign	Het
Smgc	G	A	15: 91,722,596 (GRCm39)	A9T	possibly damaging	Het
Snx11	C	A	11: 96,661,522 (GRCm39)	W161L	probably benign	Het
Spag17	A	G	3: 99,929,068 (GRCm39)	K533E	possibly damaging	Het
Spata31g1	A	G	4: 42,971,512 (GRCm39)	I282V	probably benign	Het
Speer4b	A	G	5: 27,702,011 (GRCm39)	S250P	probably damaging	Het
Spta1	A	T	1: 174,041,061 (GRCm39)	H1287L	probably benign	Het
Surf2	T	C	2: 26,809,767 (GRCm39)	F239S	probably damaging	Het
Tada1	G	A	1: 166,214,319 (GRCm39)	R106H	possibly damaging	Het
Tbc1d22a	C	A	15: 86,235,852 (GRCm39)		probably null	Het
Tbcd	A	G	11: 121,387,886 (GRCm39)	Q339R	probably benign	Het
Tdrd7	A	G	4: 45,994,445 (GRCm39)	H281R	probably benign	Het
Tomm5	A	G	4: 45,107,915 (GRCm39)		probably null	Het
Ttc7	T	C	17: 87,669,373 (GRCm39)		probably null	Het
Ulk1	A	T	5: 110,937,382 (GRCm39)	F638Y	probably damaging	Het
Vps35l	T	A	7: 118,409,195 (GRCm39)	I612N	probably damaging	Het
Wdr93	C	A	7: 79,418,109 (GRCm39)	D277E	probably damaging	Het
Znrf3	T	C	11: 5,231,477 (GRCm39)	R583G	probably damaging	Het
Zscan29	T	A	2: 120,991,641 (GRCm39)	I716F	probably damaging	Het

Other mutations in Dmap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00786:Dmap1	APN	4	117,533,593 (GRCm39)	missense	possibly damaging	0.67
IGL01517:Dmap1	APN	4	117,533,206 (GRCm39)	missense	probably damaging	1.00
IGL02926:Dmap1	APN	4	117,539,085 (GRCm39)	missense	probably benign	0.01
R0118:Dmap1	UTSW	4	117,533,680 (GRCm39)	missense	probably damaging	1.00
R2504:Dmap1	UTSW	4	117,532,495 (GRCm39)	missense	probably damaging	1.00
R2940:Dmap1	UTSW	4	117,533,202 (GRCm39)	missense	possibly damaging	0.72
R4168:Dmap1	UTSW	4	117,538,507 (GRCm39)	missense	possibly damaging	0.91
R4723:Dmap1	UTSW	4	117,533,236 (GRCm39)	missense	probably benign	0.05
R4975:Dmap1	UTSW	4	117,538,233 (GRCm39)	missense	possibly damaging	0.91
R5797:Dmap1	UTSW	4	117,532,677 (GRCm39)	missense	possibly damaging	0.94
R5905:Dmap1	UTSW	4	117,533,963 (GRCm39)	missense	probably benign	0.00
R5987:Dmap1	UTSW	4	117,538,039 (GRCm39)	critical splice donor site	probably null
R6117:Dmap1	UTSW	4	117,532,732 (GRCm39)	splice site	probably null
R9484:Dmap1	UTSW	4	117,533,308 (GRCm39)	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- AGAATACCCACTGAAGCTGGGGAC -3'
(R):5'- TTGATGCTGGGCATGAGAGACG -3'

Sequencing Primer
(F):5'- ACCCTGTGCCAGATGACC -3'
(R):5'- ACAGCTAGAGCGGCTTTAC -3'

Posted On

2014-04-24