Incidental Mutation 'R1586:Dmap1'
ID177497
Institutional Source Beutler Lab
Gene Symbol Dmap1
Ensembl Gene ENSMUSG00000009640
Gene NameDNA methyltransferase 1-associated protein 1
Synonyms1500016M21Rik
MMRRC Submission 039623-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1586 (G1)
Quality Score175
Status Validated
Chromosome4
Chromosomal Location117674681-117682273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117676122 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 245 (E245G)
Ref Sequence ENSEMBL: ENSMUSP00000099748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037127] [ENSMUST00000102687]
Predicted Effect probably benign
Transcript: ENSMUST00000037127
SMART Domains Protein: ENSMUSP00000042796
Gene: ENSMUSG00000033423

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
EXOIII 145 329 1.17e-42 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102687
AA Change: E245G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099748
Gene: ENSMUSG00000009640
AA Change: E245G

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
SANT 148 201 3.38e-2 SMART
Pfam:DMAP1 243 404 7.1e-76 PFAM
low complexity region 449 467 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146384
Meta Mutation Damage Score 0.7464 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 93% (65/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of several, distinct complexes involved in the repression or activation of transcription. The encoded protein can independently repress transcription and is targeted to replication foci throughout S phase by interacting directly with the N-terminus of DNA methyltransferase 1. During late S phase, histone deacetylase 2 is added to this complex, providing a means to deacetylate histones in transcriptionally inactive heterochromatin following replication. The encoded protein is also a component of the nucleosome acetyltransferase of H4 complex and interacts with the transcriptional corepressor tumor susceptibility gene 101 and the pro-apoptotic death-associated protein 6, among others. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die prior to implantation with no 8-cell embryos detected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,512 I282V probably benign Het
9030624J02Rik T A 7: 118,809,972 I612N probably damaging Het
Abca2 C T 2: 25,447,216 A2361V probably damaging Het
Alpi A G 1: 87,100,201 I219T probably damaging Het
Anapc10 T A 8: 79,775,143 M180K probably benign Het
Ank3 A G 10: 69,877,878 I431V probably damaging Het
Anxa8 T A 14: 34,093,937 D182E probably damaging Het
Atp1a3 T A 7: 24,979,383 I945F probably damaging Het
Atp2a3 T C 11: 72,991,744 S1019P probably damaging Het
Cbs T A 17: 31,622,474 I258F probably damaging Het
Cic T C 7: 25,285,961 S277P probably damaging Het
Cidea T A 18: 67,360,160 V83E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca3a2 A G 3: 144,810,716 I373T possibly damaging Het
Cpvl T A 6: 53,926,901 D293V probably damaging Het
Cryz A G 3: 154,611,510 N122S probably benign Het
Epha2 C T 4: 141,318,605 probably benign Het
Fam222b C T 11: 78,154,521 L303F probably damaging Het
Fastkd1 T C 2: 69,712,148 D105G probably benign Het
Fat4 T A 3: 38,888,860 L634Q probably damaging Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fig4 A G 10: 41,265,427 F279L probably damaging Het
Guk1 A G 11: 59,186,849 S22P probably damaging Het
Kmt2d A G 15: 98,865,053 probably benign Het
Macf1 A T 4: 123,509,846 S727T probably benign Het
Mgea5 T G 19: 45,776,910 T153P possibly damaging Het
Mki67 T A 7: 135,713,972 K54* probably null Het
Ms4a8a T C 19: 11,076,332 T137A possibly damaging Het
Myo5c T C 9: 75,267,031 Y557H probably damaging Het
Nav3 T A 10: 109,853,254 K387N probably damaging Het
Olfr1432 G T 19: 12,228,877 A223E probably damaging Het
Pde4c T A 8: 70,746,859 Y223N probably damaging Het
Psd T G 19: 46,314,798 E715A probably damaging Het
Rpl7 A T 1: 16,102,583 S171T probably benign Het
Rrm1 A G 7: 102,466,905 *66W probably null Het
Scgb1b3 T A 7: 31,375,963 H79Q probably damaging Het
Serpinb9 A T 13: 33,015,486 M255L probably benign Het
Slc35a4 T C 18: 36,683,005 V296A probably benign Het
Smgc G A 15: 91,838,393 A9T possibly damaging Het
Snx11 C A 11: 96,770,696 W161L probably benign Het
Spag17 A G 3: 100,021,752 K533E possibly damaging Het
Speer4b A G 5: 27,497,013 S250P probably damaging Het
Spta1 A T 1: 174,213,495 H1287L probably benign Het
Surf2 T C 2: 26,919,755 F239S probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tbc1d22a C A 15: 86,351,651 probably null Het
Tbcd A G 11: 121,497,060 Q339R probably benign Het
Tdrd7 A G 4: 45,994,445 H281R probably benign Het
Tomm5 A G 4: 45,107,915 probably null Het
Ttc7 T C 17: 87,361,945 probably null Het
Ulk1 A T 5: 110,789,516 F638Y probably damaging Het
Wdr93 C A 7: 79,768,361 D277E probably damaging Het
Znrf3 T C 11: 5,281,477 R583G probably damaging Het
Zscan29 T A 2: 121,161,160 I716F probably damaging Het
Other mutations in Dmap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Dmap1 APN 4 117676396 missense possibly damaging 0.67
IGL01517:Dmap1 APN 4 117676009 missense probably damaging 1.00
IGL02926:Dmap1 APN 4 117681888 missense probably benign 0.01
R0118:Dmap1 UTSW 4 117676483 missense probably damaging 1.00
R2504:Dmap1 UTSW 4 117675298 missense probably damaging 1.00
R2940:Dmap1 UTSW 4 117676005 missense possibly damaging 0.72
R4168:Dmap1 UTSW 4 117681310 missense possibly damaging 0.91
R4723:Dmap1 UTSW 4 117676039 missense probably benign 0.05
R4975:Dmap1 UTSW 4 117681036 missense possibly damaging 0.91
R5797:Dmap1 UTSW 4 117675480 missense possibly damaging 0.94
R5905:Dmap1 UTSW 4 117676766 missense probably benign 0.00
R5987:Dmap1 UTSW 4 117680842 critical splice donor site probably null
R6117:Dmap1 UTSW 4 117675535 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGAATACCCACTGAAGCTGGGGAC -3'
(R):5'- TTGATGCTGGGCATGAGAGACG -3'

Sequencing Primer
(F):5'- ACCCTGTGCCAGATGACC -3'
(R):5'- ACAGCTAGAGCGGCTTTAC -3'
Posted On2014-04-24