Incidental Mutation 'R1586:Cpvl'
ID177504
Institutional Source Beutler Lab
Gene Symbol Cpvl
Ensembl Gene ENSMUSG00000052955
Gene Namecarboxypeptidase, vitellogenic-like
Synonyms
MMRRC Submission 039623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1586 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location53873279-53978671 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53926901 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 293 (D293V)
Ref Sequence ENSEMBL: ENSMUSP00000144942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166545] [ENSMUST00000203101] [ENSMUST00000204674]
Predicted Effect probably damaging
Transcript: ENSMUST00000166545
AA Change: D293V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131462
Gene: ENSMUSG00000052955
AA Change: D293V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Peptidase_S10 66 470 3.5e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203101
AA Change: D249V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145288
Gene: ENSMUSG00000052955
AA Change: D249V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Peptidase_S10 66 266 3.8e-68 PFAM
Pfam:Peptidase_S10 262 426 5.2e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204674
AA Change: D293V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144942
Gene: ENSMUSG00000052955
AA Change: D293V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Peptidase_S10 66 470 3.5e-106 PFAM
Meta Mutation Damage Score 0.8710 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 93% (65/70)
MGI Phenotype FUNCTION: This gene encodes a member of the serine carboxypeptidase family of proteases that cleave amino acids from the C-terminus of a protein substrate. The human ortholog of this gene, where it was first characterized, was found to be upregulated during the maturation of monocytes to macrophages. The encoded protein may be involved in antigen processing, digestion of phagocytosed proteins in the lysosome and lamellipodium formation. Disruption of this gene in mice was found to cause embryonic lethality. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a transposon insertion allele die prior to birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,512 I282V probably benign Het
9030624J02Rik T A 7: 118,809,972 I612N probably damaging Het
Abca2 C T 2: 25,447,216 A2361V probably damaging Het
Alpi A G 1: 87,100,201 I219T probably damaging Het
Anapc10 T A 8: 79,775,143 M180K probably benign Het
Ank3 A G 10: 69,877,878 I431V probably damaging Het
Anxa8 T A 14: 34,093,937 D182E probably damaging Het
Atp1a3 T A 7: 24,979,383 I945F probably damaging Het
Atp2a3 T C 11: 72,991,744 S1019P probably damaging Het
Cbs T A 17: 31,622,474 I258F probably damaging Het
Cic T C 7: 25,285,961 S277P probably damaging Het
Cidea T A 18: 67,360,160 V83E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca3a2 A G 3: 144,810,716 I373T possibly damaging Het
Cryz A G 3: 154,611,510 N122S probably benign Het
Dmap1 T C 4: 117,676,122 E245G probably damaging Het
Epha2 C T 4: 141,318,605 probably benign Het
Fam222b C T 11: 78,154,521 L303F probably damaging Het
Fastkd1 T C 2: 69,712,148 D105G probably benign Het
Fat4 T A 3: 38,888,860 L634Q probably damaging Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fig4 A G 10: 41,265,427 F279L probably damaging Het
Guk1 A G 11: 59,186,849 S22P probably damaging Het
Kmt2d A G 15: 98,865,053 probably benign Het
Macf1 A T 4: 123,509,846 S727T probably benign Het
Mgea5 T G 19: 45,776,910 T153P possibly damaging Het
Mki67 T A 7: 135,713,972 K54* probably null Het
Ms4a8a T C 19: 11,076,332 T137A possibly damaging Het
Myo5c T C 9: 75,267,031 Y557H probably damaging Het
Nav3 T A 10: 109,853,254 K387N probably damaging Het
Olfr1432 G T 19: 12,228,877 A223E probably damaging Het
Pde4c T A 8: 70,746,859 Y223N probably damaging Het
Psd T G 19: 46,314,798 E715A probably damaging Het
Rpl7 A T 1: 16,102,583 S171T probably benign Het
Rrm1 A G 7: 102,466,905 *66W probably null Het
Scgb1b3 T A 7: 31,375,963 H79Q probably damaging Het
Serpinb9 A T 13: 33,015,486 M255L probably benign Het
Slc35a4 T C 18: 36,683,005 V296A probably benign Het
Smgc G A 15: 91,838,393 A9T possibly damaging Het
Snx11 C A 11: 96,770,696 W161L probably benign Het
Spag17 A G 3: 100,021,752 K533E possibly damaging Het
Speer4b A G 5: 27,497,013 S250P probably damaging Het
Spta1 A T 1: 174,213,495 H1287L probably benign Het
Surf2 T C 2: 26,919,755 F239S probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tbc1d22a C A 15: 86,351,651 probably null Het
Tbcd A G 11: 121,497,060 Q339R probably benign Het
Tdrd7 A G 4: 45,994,445 H281R probably benign Het
Tomm5 A G 4: 45,107,915 probably null Het
Ttc7 T C 17: 87,361,945 probably null Het
Ulk1 A T 5: 110,789,516 F638Y probably damaging Het
Wdr93 C A 7: 79,768,361 D277E probably damaging Het
Znrf3 T C 11: 5,281,477 R583G probably damaging Het
Zscan29 T A 2: 121,161,160 I716F probably damaging Het
Other mutations in Cpvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Cpvl APN 6 53974655 missense possibly damaging 0.92
IGL01340:Cpvl APN 6 53896451 nonsense probably null
IGL02596:Cpvl APN 6 53932010 missense probably damaging 1.00
PIT4472001:Cpvl UTSW 6 53896479 missense possibly damaging 0.69
R0242:Cpvl UTSW 6 53932500 missense possibly damaging 0.95
R0242:Cpvl UTSW 6 53932500 missense possibly damaging 0.95
R1987:Cpvl UTSW 6 53954611 missense probably benign 0.01
R4609:Cpvl UTSW 6 53974620 critical splice donor site probably null
R4664:Cpvl UTSW 6 53931933 missense probably benign 0.00
R4665:Cpvl UTSW 6 53931933 missense probably benign 0.00
R4666:Cpvl UTSW 6 53931933 missense probably benign 0.00
R5863:Cpvl UTSW 6 53873428 missense probably damaging 0.99
R5909:Cpvl UTSW 6 53932428 missense probably damaging 0.98
R6163:Cpvl UTSW 6 53873518 missense probably damaging 1.00
R6948:Cpvl UTSW 6 53896483 missense possibly damaging 0.94
R7023:Cpvl UTSW 6 53967812 missense probably benign 0.00
R7262:Cpvl UTSW 6 53932515 missense probably damaging 1.00
R7330:Cpvl UTSW 6 53974759 missense probably benign 0.43
R7488:Cpvl UTSW 6 53947742 missense probably damaging 1.00
R7694:Cpvl UTSW 6 53932517 nonsense probably null
R7728:Cpvl UTSW 6 53925290 missense probably benign 0.00
R7750:Cpvl UTSW 6 53926901 missense probably damaging 1.00
R7768:Cpvl UTSW 6 53896491 missense possibly damaging 0.91
R7773:Cpvl UTSW 6 53931905 critical splice donor site probably null
R7868:Cpvl UTSW 6 53974760 missense possibly damaging 0.64
X0062:Cpvl UTSW 6 53926852 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GTAGGAAACAACTCCCACAGGTCAG -3'
(R):5'- GGGCACATGCACCTATATGCACAC -3'

Sequencing Primer
(F):5'- ACTCCCACAGGTCAGGAGATG -3'
(R):5'- atgcacCTATATGCACACAATGC -3'
Posted On2014-04-24