Incidental Mutation 'R1586:Rrm1'
ID177510
Institutional Source Beutler Lab
Gene Symbol Rrm1
Ensembl Gene ENSMUSG00000030978
Gene Nameribonucleotide reductase M1
SynonymsRnrM1
MMRRC Submission 039623-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1586 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102441695-102469771 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 102466905 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 66 (*66W)
Ref Sequence ENSEMBL: ENSMUSP00000147865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033283] [ENSMUST00000209630]
Predicted Effect probably damaging
Transcript: ENSMUST00000033283
AA Change: K677E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033283
Gene: ENSMUSG00000030978
AA Change: K677E

DomainStartEndE-ValueType
Pfam:ATP-cone 1 89 8.7e-21 PFAM
Pfam:Ribonuc_red_lgN 141 213 2.8e-25 PFAM
Pfam:Ribonuc_red_lgC 216 738 1.6e-197 PFAM
coiled coil region 749 778 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209630
AA Change: *66W
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210543
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 93% (65/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large and catalytic subunit of ribonucleotide reductase, an enzyme essential for the conversion of ribonucleotides into deoxyribonucleotides. A pool of available deoxyribonucleotides is important for DNA replication during S phase of the cell cycle as well as multiple DNA repair processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic letahlity before E3.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,512 I282V probably benign Het
9030624J02Rik T A 7: 118,809,972 I612N probably damaging Het
Abca2 C T 2: 25,447,216 A2361V probably damaging Het
Alpi A G 1: 87,100,201 I219T probably damaging Het
Anapc10 T A 8: 79,775,143 M180K probably benign Het
Ank3 A G 10: 69,877,878 I431V probably damaging Het
Anxa8 T A 14: 34,093,937 D182E probably damaging Het
Atp1a3 T A 7: 24,979,383 I945F probably damaging Het
Atp2a3 T C 11: 72,991,744 S1019P probably damaging Het
Cbs T A 17: 31,622,474 I258F probably damaging Het
Cic T C 7: 25,285,961 S277P probably damaging Het
Cidea T A 18: 67,360,160 V83E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca3a2 A G 3: 144,810,716 I373T possibly damaging Het
Cpvl T A 6: 53,926,901 D293V probably damaging Het
Cryz A G 3: 154,611,510 N122S probably benign Het
Dmap1 T C 4: 117,676,122 E245G probably damaging Het
Epha2 C T 4: 141,318,605 probably benign Het
Fam222b C T 11: 78,154,521 L303F probably damaging Het
Fastkd1 T C 2: 69,712,148 D105G probably benign Het
Fat4 T A 3: 38,888,860 L634Q probably damaging Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fig4 A G 10: 41,265,427 F279L probably damaging Het
Guk1 A G 11: 59,186,849 S22P probably damaging Het
Kmt2d A G 15: 98,865,053 probably benign Het
Macf1 A T 4: 123,509,846 S727T probably benign Het
Mgea5 T G 19: 45,776,910 T153P possibly damaging Het
Mki67 T A 7: 135,713,972 K54* probably null Het
Ms4a8a T C 19: 11,076,332 T137A possibly damaging Het
Myo5c T C 9: 75,267,031 Y557H probably damaging Het
Nav3 T A 10: 109,853,254 K387N probably damaging Het
Olfr1432 G T 19: 12,228,877 A223E probably damaging Het
Pde4c T A 8: 70,746,859 Y223N probably damaging Het
Psd T G 19: 46,314,798 E715A probably damaging Het
Rpl7 A T 1: 16,102,583 S171T probably benign Het
Scgb1b3 T A 7: 31,375,963 H79Q probably damaging Het
Serpinb9 A T 13: 33,015,486 M255L probably benign Het
Slc35a4 T C 18: 36,683,005 V296A probably benign Het
Smgc G A 15: 91,838,393 A9T possibly damaging Het
Snx11 C A 11: 96,770,696 W161L probably benign Het
Spag17 A G 3: 100,021,752 K533E possibly damaging Het
Speer4b A G 5: 27,497,013 S250P probably damaging Het
Spta1 A T 1: 174,213,495 H1287L probably benign Het
Surf2 T C 2: 26,919,755 F239S probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tbc1d22a C A 15: 86,351,651 probably null Het
Tbcd A G 11: 121,497,060 Q339R probably benign Het
Tdrd7 A G 4: 45,994,445 H281R probably benign Het
Tomm5 A G 4: 45,107,915 probably null Het
Ttc7 T C 17: 87,361,945 probably null Het
Ulk1 A T 5: 110,789,516 F638Y probably damaging Het
Wdr93 C A 7: 79,768,361 D277E probably damaging Het
Znrf3 T C 11: 5,281,477 R583G probably damaging Het
Zscan29 T A 2: 121,161,160 I716F probably damaging Het
Other mutations in Rrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rrm1 APN 7 102454507 nonsense probably null
IGL01431:Rrm1 APN 7 102457552 splice site probably benign
IGL03251:Rrm1 APN 7 102457206 missense probably damaging 1.00
IGL03401:Rrm1 APN 7 102465744 missense possibly damaging 0.81
R0454:Rrm1 UTSW 7 102466926 missense probably damaging 1.00
R0548:Rrm1 UTSW 7 102467067 critical splice donor site probably null
R0759:Rrm1 UTSW 7 102457561 missense probably benign 0.32
R1575:Rrm1 UTSW 7 102456514 missense probably damaging 1.00
R1625:Rrm1 UTSW 7 102468347 missense probably damaging 0.98
R2207:Rrm1 UTSW 7 102442026 start codon destroyed probably null 0.98
R2432:Rrm1 UTSW 7 102443072 missense probably benign 0.03
R2513:Rrm1 UTSW 7 102460689 missense probably damaging 0.99
R3796:Rrm1 UTSW 7 102465703 splice site probably null
R3914:Rrm1 UTSW 7 102457174 missense probably damaging 1.00
R4179:Rrm1 UTSW 7 102457198 missense probably damaging 1.00
R4302:Rrm1 UTSW 7 102447824 missense probably benign 0.00
R4379:Rrm1 UTSW 7 102446593 missense probably damaging 1.00
R4416:Rrm1 UTSW 7 102447801 missense probably benign 0.06
R4690:Rrm1 UTSW 7 102447879 missense probably benign
R4939:Rrm1 UTSW 7 102466924 missense probably benign 0.34
R5433:Rrm1 UTSW 7 102465767 missense probably damaging 0.97
R5445:Rrm1 UTSW 7 102451023 missense possibly damaging 0.77
R6120:Rrm1 UTSW 7 102460856 splice site probably null
R6198:Rrm1 UTSW 7 102446729 critical splice donor site probably null
R6369:Rrm1 UTSW 7 102446702 missense probably damaging 0.97
R6699:Rrm1 UTSW 7 102460825 missense probably damaging 1.00
R7009:Rrm1 UTSW 7 102460334 missense probably damaging 1.00
R7491:Rrm1 UTSW 7 102454557 missense probably damaging 1.00
R8024:Rrm1 UTSW 7 102457265 missense probably benign 0.00
R8276:Rrm1 UTSW 7 102460852 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGCAGAAAGTGTAGCATCAGTCAG -3'
(R):5'- AGTGCTCAACCAACCTGCTTCC -3'

Sequencing Primer
(F):5'- GGATGTCTAAGTCACTGCATCAC -3'
(R):5'- GCTTCCAACCGTAGAAGTGC -3'
Posted On2014-04-24