Mutagenetix > Incidental Mutations

Incidental Mutation 'R1586:Rrm1'

177510

Institutional Source

Beutler Lab

Gene Symbol

Rrm1

Ensembl Gene

ENSMUSG00000030978

Gene Name

ribonucleotide reductase M1

Synonyms

RnrM1

MMRRC Submission

039623-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R1586 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102441695-102469771 bp(+) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

A to G at 102466905 bp

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Tryptophan at position 66 (*66W)

Ref Sequence

ENSEMBL: ENSMUSP00000147865 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033283] [ENSMUST00000209630]

Predicted Effect

probably damaging
Transcript: ENSMUST00000033283
AA Change: K677E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000033283
Gene: ENSMUSG00000030978
AA Change: K677E

Domain	Start	End	E-Value	Type
Pfam:ATP-cone	1	89	8.7e-21	PFAM
Pfam:Ribonuc_red_lgN	141	213	2.8e-25	PFAM
Pfam:Ribonuc_red_lgC	216	738	1.6e-197	PFAM
coiled coil region	749	778	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000209630
AA Change: *66W

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210543

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.2%
20x: 88.8%

Validation Efficiency

93% (65/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large and catalytic subunit of ribonucleotide reductase, an enzyme essential for the conversion of ribonucleotides into deoxyribonucleotides. A pool of available deoxyribonucleotides is important for DNA replication during S phase of the cell cycle as well as multiple DNA repair processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic letahlity before E3.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,971,512	I282V	probably benign	Het
9030624J02Rik	T	A	7: 118,809,972	I612N	probably damaging	Het
Abca2	C	T	2: 25,447,216	A2361V	probably damaging	Het
Alpi	A	G	1: 87,100,201	I219T	probably damaging	Het
Anapc10	T	A	8: 79,775,143	M180K	probably benign	Het
Ank3	A	G	10: 69,877,878	I431V	probably damaging	Het
Anxa8	T	A	14: 34,093,937	D182E	probably damaging	Het
Atp1a3	T	A	7: 24,979,383	I945F	probably damaging	Het
Atp2a3	T	C	11: 72,991,744	S1019P	probably damaging	Het
Cbs	T	A	17: 31,622,474	I258F	probably damaging	Het
Cic	T	C	7: 25,285,961	S277P	probably damaging	Het
Cidea	T	A	18: 67,360,160	V83E	probably damaging	Het
Cilp	G	A	9: 65,279,715	G1031S	probably damaging	Het
Clca3a2	A	G	3: 144,810,716	I373T	possibly damaging	Het
Cpvl	T	A	6: 53,926,901	D293V	probably damaging	Het
Cryz	A	G	3: 154,611,510	N122S	probably benign	Het
Dmap1	T	C	4: 117,676,122	E245G	probably damaging	Het
Epha2	C	T	4: 141,318,605		probably benign	Het
Fam222b	C	T	11: 78,154,521	L303F	probably damaging	Het
Fastkd1	T	C	2: 69,712,148	D105G	probably benign	Het
Fat4	T	A	3: 38,888,860	L634Q	probably damaging	Het
Fbxo10	A	T	4: 45,042,036	I731N	possibly damaging	Het
Fig4	A	G	10: 41,265,427	F279L	probably damaging	Het
Guk1	A	G	11: 59,186,849	S22P	probably damaging	Het
Kmt2d	A	G	15: 98,865,053		probably benign	Het
Macf1	A	T	4: 123,509,846	S727T	probably benign	Het
Mgea5	T	G	19: 45,776,910	T153P	possibly damaging	Het
Mki67	T	A	7: 135,713,972	K54*	probably null	Het
Ms4a8a	T	C	19: 11,076,332	T137A	possibly damaging	Het
Myo5c	T	C	9: 75,267,031	Y557H	probably damaging	Het
Nav3	T	A	10: 109,853,254	K387N	probably damaging	Het
Olfr1432	G	T	19: 12,228,877	A223E	probably damaging	Het
Pde4c	T	A	8: 70,746,859	Y223N	probably damaging	Het
Psd	T	G	19: 46,314,798	E715A	probably damaging	Het
Rpl7	A	T	1: 16,102,583	S171T	probably benign	Het
Scgb1b3	T	A	7: 31,375,963	H79Q	probably damaging	Het
Serpinb9	A	T	13: 33,015,486	M255L	probably benign	Het
Slc35a4	T	C	18: 36,683,005	V296A	probably benign	Het
Smgc	G	A	15: 91,838,393	A9T	possibly damaging	Het
Snx11	C	A	11: 96,770,696	W161L	probably benign	Het
Spag17	A	G	3: 100,021,752	K533E	possibly damaging	Het
Speer4b	A	G	5: 27,497,013	S250P	probably damaging	Het
Spta1	A	T	1: 174,213,495	H1287L	probably benign	Het
Surf2	T	C	2: 26,919,755	F239S	probably damaging	Het
Tada1	G	A	1: 166,386,750	R106H	possibly damaging	Het
Tbc1d22a	C	A	15: 86,351,651		probably null	Het
Tbcd	A	G	11: 121,497,060	Q339R	probably benign	Het
Tdrd7	A	G	4: 45,994,445	H281R	probably benign	Het
Tomm5	A	G	4: 45,107,915		probably null	Het
Ttc7	T	C	17: 87,361,945		probably null	Het
Ulk1	A	T	5: 110,789,516	F638Y	probably damaging	Het
Wdr93	C	A	7: 79,768,361	D277E	probably damaging	Het
Znrf3	T	C	11: 5,281,477	R583G	probably damaging	Het
Zscan29	T	A	2: 121,161,160	I716F	probably damaging	Het

Other mutations in Rrm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rrm1	APN	7	102454507	nonsense	probably null
IGL01431:Rrm1	APN	7	102457552	splice site	probably benign
IGL03251:Rrm1	APN	7	102457206	missense	probably damaging	1.00
IGL03401:Rrm1	APN	7	102465744	missense	possibly damaging	0.81
R0454:Rrm1	UTSW	7	102466926	missense	probably damaging	1.00
R0548:Rrm1	UTSW	7	102467067	critical splice donor site	probably null
R0759:Rrm1	UTSW	7	102457561	missense	probably benign	0.32
R1575:Rrm1	UTSW	7	102456514	missense	probably damaging	1.00
R1625:Rrm1	UTSW	7	102468347	missense	probably damaging	0.98
R2207:Rrm1	UTSW	7	102442026	start codon destroyed	probably null	0.98
R2432:Rrm1	UTSW	7	102443072	missense	probably benign	0.03
R2513:Rrm1	UTSW	7	102460689	missense	probably damaging	0.99
R3796:Rrm1	UTSW	7	102465703	splice site	probably null
R3914:Rrm1	UTSW	7	102457174	missense	probably damaging	1.00
R4179:Rrm1	UTSW	7	102457198	missense	probably damaging	1.00
R4302:Rrm1	UTSW	7	102447824	missense	probably benign	0.00
R4379:Rrm1	UTSW	7	102446593	missense	probably damaging	1.00
R4416:Rrm1	UTSW	7	102447801	missense	probably benign	0.06
R4690:Rrm1	UTSW	7	102447879	missense	probably benign
R4939:Rrm1	UTSW	7	102466924	missense	probably benign	0.34
R5433:Rrm1	UTSW	7	102465767	missense	probably damaging	0.97
R5445:Rrm1	UTSW	7	102451023	missense	possibly damaging	0.77
R6120:Rrm1	UTSW	7	102460856	splice site	probably null
R6198:Rrm1	UTSW	7	102446729	critical splice donor site	probably null
R6369:Rrm1	UTSW	7	102446702	missense	probably damaging	0.97
R6699:Rrm1	UTSW	7	102460825	missense	probably damaging	1.00
R7009:Rrm1	UTSW	7	102460334	missense	probably damaging	1.00
R7491:Rrm1	UTSW	7	102454557	missense	probably damaging	1.00
R8024:Rrm1	UTSW	7	102457265	missense	probably benign	0.00
R8276:Rrm1	UTSW	7	102460852	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGGCAGAAAGTGTAGCATCAGTCAG -3'
(R):5'- AGTGCTCAACCAACCTGCTTCC -3'

Sequencing Primer
(F):5'- GGATGTCTAAGTCACTGCATCAC -3'
(R):5'- GCTTCCAACCGTAGAAGTGC -3'

Posted On

2014-04-24