Incidental Mutation 'R1586:Guk1'
ID177522
Institutional Source Beutler Lab
Gene Symbol Guk1
Ensembl Gene ENSMUSG00000020444
Gene Nameguanylate kinase 1
Synonyms
MMRRC Submission 039623-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R1586 (G1)
Quality Score213
Status Validated
Chromosome11
Chromosomal Location59183875-59192212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59186849 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 22 (S22P)
Ref Sequence ENSEMBL: ENSMUSP00000130214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108790] [ENSMUST00000108793] [ENSMUST00000170202] [ENSMUST00000170895] [ENSMUST00000172714]
Predicted Effect probably benign
Transcript: ENSMUST00000108790
SMART Domains Protein: ENSMUSP00000104418
Gene: ENSMUSG00000043448

DomainStartEndE-ValueType
CNX 45 78 3.37e-17 SMART
low complexity region 101 127 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 143 193 N/A INTRINSIC
Connexin_CCC 222 288 9.88e-42 SMART
low complexity region 298 330 N/A INTRINSIC
low complexity region 347 372 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108793
SMART Domains Protein: ENSMUSP00000104421
Gene: ENSMUSG00000043448

DomainStartEndE-ValueType
CNX 45 78 3.37e-17 SMART
low complexity region 101 127 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 143 193 N/A INTRINSIC
Connexin_CCC 222 288 9.88e-42 SMART
low complexity region 298 330 N/A INTRINSIC
low complexity region 347 372 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154386
Predicted Effect probably damaging
Transcript: ENSMUST00000170202
AA Change: S34P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127566
Gene: ENSMUSG00000020444
AA Change: S34P

DomainStartEndE-ValueType
GuKc 24 210 1.36e-94 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170895
AA Change: S22P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130214
Gene: ENSMUSG00000020444
AA Change: S22P

DomainStartEndE-ValueType
GuKc 12 198 1.36e-94 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172714
AA Change: S13P

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.5054 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 93% (65/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the transfer of a phosphate group from ATP to guanosine monophosphate (GMP) to form guanosine diphosphate (GDP). The encoded protein is thought to be a good target for cancer chemotherapy. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,512 I282V probably benign Het
9030624J02Rik T A 7: 118,809,972 I612N probably damaging Het
Abca2 C T 2: 25,447,216 A2361V probably damaging Het
Alpi A G 1: 87,100,201 I219T probably damaging Het
Anapc10 T A 8: 79,775,143 M180K probably benign Het
Ank3 A G 10: 69,877,878 I431V probably damaging Het
Anxa8 T A 14: 34,093,937 D182E probably damaging Het
Atp1a3 T A 7: 24,979,383 I945F probably damaging Het
Atp2a3 T C 11: 72,991,744 S1019P probably damaging Het
Cbs T A 17: 31,622,474 I258F probably damaging Het
Cic T C 7: 25,285,961 S277P probably damaging Het
Cidea T A 18: 67,360,160 V83E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca3a2 A G 3: 144,810,716 I373T possibly damaging Het
Cpvl T A 6: 53,926,901 D293V probably damaging Het
Cryz A G 3: 154,611,510 N122S probably benign Het
Dmap1 T C 4: 117,676,122 E245G probably damaging Het
Epha2 C T 4: 141,318,605 probably benign Het
Fam222b C T 11: 78,154,521 L303F probably damaging Het
Fastkd1 T C 2: 69,712,148 D105G probably benign Het
Fat4 T A 3: 38,888,860 L634Q probably damaging Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fig4 A G 10: 41,265,427 F279L probably damaging Het
Kmt2d A G 15: 98,865,053 probably benign Het
Macf1 A T 4: 123,509,846 S727T probably benign Het
Mgea5 T G 19: 45,776,910 T153P possibly damaging Het
Mki67 T A 7: 135,713,972 K54* probably null Het
Ms4a8a T C 19: 11,076,332 T137A possibly damaging Het
Myo5c T C 9: 75,267,031 Y557H probably damaging Het
Nav3 T A 10: 109,853,254 K387N probably damaging Het
Olfr1432 G T 19: 12,228,877 A223E probably damaging Het
Pde4c T A 8: 70,746,859 Y223N probably damaging Het
Psd T G 19: 46,314,798 E715A probably damaging Het
Rpl7 A T 1: 16,102,583 S171T probably benign Het
Rrm1 A G 7: 102,466,905 *66W probably null Het
Scgb1b3 T A 7: 31,375,963 H79Q probably damaging Het
Serpinb9 A T 13: 33,015,486 M255L probably benign Het
Slc35a4 T C 18: 36,683,005 V296A probably benign Het
Smgc G A 15: 91,838,393 A9T possibly damaging Het
Snx11 C A 11: 96,770,696 W161L probably benign Het
Spag17 A G 3: 100,021,752 K533E possibly damaging Het
Speer4b A G 5: 27,497,013 S250P probably damaging Het
Spta1 A T 1: 174,213,495 H1287L probably benign Het
Surf2 T C 2: 26,919,755 F239S probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tbc1d22a C A 15: 86,351,651 probably null Het
Tbcd A G 11: 121,497,060 Q339R probably benign Het
Tdrd7 A G 4: 45,994,445 H281R probably benign Het
Tomm5 A G 4: 45,107,915 probably null Het
Ttc7 T C 17: 87,361,945 probably null Het
Ulk1 A T 5: 110,789,516 F638Y probably damaging Het
Wdr93 C A 7: 79,768,361 D277E probably damaging Het
Znrf3 T C 11: 5,281,477 R583G probably damaging Het
Zscan29 T A 2: 121,161,160 I716F probably damaging Het
Other mutations in Guk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0254:Guk1 UTSW 11 59186028 missense probably damaging 0.96
R0838:Guk1 UTSW 11 59185095 missense probably damaging 1.00
R0839:Guk1 UTSW 11 59185095 missense probably damaging 1.00
R0840:Guk1 UTSW 11 59185095 missense probably damaging 1.00
R1729:Guk1 UTSW 11 59185312 missense probably damaging 1.00
R1784:Guk1 UTSW 11 59185312 missense probably damaging 1.00
R1795:Guk1 UTSW 11 59186813 missense probably benign 0.05
R7411:Guk1 UTSW 11 59185985 missense
R7446:Guk1 UTSW 11 59186024 missense probably benign 0.31
RF018:Guk1 UTSW 11 59186408 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGTGCATCTGGGGACTCTAGGAAC -3'
(R):5'- CAGATTCTGAAGGGCAGCCTCTATG -3'

Sequencing Primer
(F):5'- GACTCTAGGAACAGTCCTGTG -3'
(R):5'- GGATATTGGAATCCTGTCAGCC -3'
Posted On2014-04-24