Incidental Mutation 'R1586:Ttc7'
ID177533
Institutional Source Beutler Lab
Gene Symbol Ttc7
Ensembl Gene ENSMUSG00000036918
Gene Nametetratricopeptide repeat domain 7
Synonyms1110035E02Rik, fsn, hea, 1700007L07Rik
MMRRC Submission 039623-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.836) question?
Stock #R1586 (G1)
Quality Score196
Status Validated
Chromosome17
Chromosomal Location87282886-87381769 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 87361945 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041110] [ENSMUST00000125875] [ENSMUST00000144204] [ENSMUST00000154255]
Predicted Effect probably null
Transcript: ENSMUST00000041110
SMART Domains Protein: ENSMUSP00000040771
Gene: ENSMUSG00000036918

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 68 76 N/A INTRINSIC
Pfam:TPR_9 387 458 8.7e-4 PFAM
Blast:TPR 488 532 7e-20 BLAST
Blast:TPR 534 566 3e-7 BLAST
TPR 567 600 1.11e1 SMART
low complexity region 666 684 N/A INTRINSIC
TPR 711 744 7.89e1 SMART
TPR 745 778 3.87e-2 SMART
TPR 779 812 9.99e1 SMART
TPR 813 846 1.39e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125875
SMART Domains Protein: ENSMUSP00000115351
Gene: ENSMUSG00000036918

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 68 76 N/A INTRINSIC
Pfam:TPR_9 387 458 1.2e-3 PFAM
Blast:TPR 488 532 7e-20 BLAST
Blast:TPR 534 566 3e-7 BLAST
TPR 567 600 1.11e1 SMART
low complexity region 666 684 N/A INTRINSIC
TPR 711 744 7.89e1 SMART
TPR 745 778 3.87e-2 SMART
low complexity region 787 801 N/A INTRINSIC
low complexity region 806 818 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144204
SMART Domains Protein: ENSMUSP00000122563
Gene: ENSMUSG00000036918

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 68 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159031
Meta Mutation Damage Score 0.9501 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 93% (65/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing tetratricopeptide repeats. Mutations in this gene disrupt intestinal development and can cause early onset inflammatory bowel disease and intestinal atresia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit reduced growth, sparse hair, thickened, scaly skin, increased numbers of splenic B cells, macrophages, and erythroid cells, elevated IgE, glomerulonephritis, and forestomach papillomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,512 I282V probably benign Het
9030624J02Rik T A 7: 118,809,972 I612N probably damaging Het
Abca2 C T 2: 25,447,216 A2361V probably damaging Het
Alpi A G 1: 87,100,201 I219T probably damaging Het
Anapc10 T A 8: 79,775,143 M180K probably benign Het
Ank3 A G 10: 69,877,878 I431V probably damaging Het
Anxa8 T A 14: 34,093,937 D182E probably damaging Het
Atp1a3 T A 7: 24,979,383 I945F probably damaging Het
Atp2a3 T C 11: 72,991,744 S1019P probably damaging Het
Cbs T A 17: 31,622,474 I258F probably damaging Het
Cic T C 7: 25,285,961 S277P probably damaging Het
Cidea T A 18: 67,360,160 V83E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca3a2 A G 3: 144,810,716 I373T possibly damaging Het
Cpvl T A 6: 53,926,901 D293V probably damaging Het
Cryz A G 3: 154,611,510 N122S probably benign Het
Dmap1 T C 4: 117,676,122 E245G probably damaging Het
Epha2 C T 4: 141,318,605 probably benign Het
Fam222b C T 11: 78,154,521 L303F probably damaging Het
Fastkd1 T C 2: 69,712,148 D105G probably benign Het
Fat4 T A 3: 38,888,860 L634Q probably damaging Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fig4 A G 10: 41,265,427 F279L probably damaging Het
Guk1 A G 11: 59,186,849 S22P probably damaging Het
Kmt2d A G 15: 98,865,053 probably benign Het
Macf1 A T 4: 123,509,846 S727T probably benign Het
Mgea5 T G 19: 45,776,910 T153P possibly damaging Het
Mki67 T A 7: 135,713,972 K54* probably null Het
Ms4a8a T C 19: 11,076,332 T137A possibly damaging Het
Myo5c T C 9: 75,267,031 Y557H probably damaging Het
Nav3 T A 10: 109,853,254 K387N probably damaging Het
Olfr1432 G T 19: 12,228,877 A223E probably damaging Het
Pde4c T A 8: 70,746,859 Y223N probably damaging Het
Psd T G 19: 46,314,798 E715A probably damaging Het
Rpl7 A T 1: 16,102,583 S171T probably benign Het
Rrm1 A G 7: 102,466,905 *66W probably null Het
Scgb1b3 T A 7: 31,375,963 H79Q probably damaging Het
Serpinb9 A T 13: 33,015,486 M255L probably benign Het
Slc35a4 T C 18: 36,683,005 V296A probably benign Het
Smgc G A 15: 91,838,393 A9T possibly damaging Het
Snx11 C A 11: 96,770,696 W161L probably benign Het
Spag17 A G 3: 100,021,752 K533E possibly damaging Het
Speer4b A G 5: 27,497,013 S250P probably damaging Het
Spta1 A T 1: 174,213,495 H1287L probably benign Het
Surf2 T C 2: 26,919,755 F239S probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tbc1d22a C A 15: 86,351,651 probably null Het
Tbcd A G 11: 121,497,060 Q339R probably benign Het
Tdrd7 A G 4: 45,994,445 H281R probably benign Het
Tomm5 A G 4: 45,107,915 probably null Het
Ulk1 A T 5: 110,789,516 F638Y probably damaging Het
Wdr93 C A 7: 79,768,361 D277E probably damaging Het
Znrf3 T C 11: 5,281,477 R583G probably damaging Het
Zscan29 T A 2: 121,161,160 I716F probably damaging Het
Other mutations in Ttc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Ttc7 APN 17 87363564 missense possibly damaging 0.66
IGL00980:Ttc7 APN 17 87321446 missense possibly damaging 0.82
IGL01638:Ttc7 APN 17 87359112 critical splice acceptor site probably null
IGL01896:Ttc7 APN 17 87359124 missense probably damaging 0.99
IGL02643:Ttc7 APN 17 87340899 missense possibly damaging 0.85
R0164:Ttc7 UTSW 17 87379895 missense probably damaging 1.00
R0164:Ttc7 UTSW 17 87379895 missense probably damaging 1.00
R0310:Ttc7 UTSW 17 87361864 missense probably benign 0.00
R0412:Ttc7 UTSW 17 87330044 missense probably benign 0.20
R0520:Ttc7 UTSW 17 87359151 missense possibly damaging 0.93
R1216:Ttc7 UTSW 17 87346578 missense possibly damaging 0.85
R1262:Ttc7 UTSW 17 87340936 missense probably benign 0.09
R1337:Ttc7 UTSW 17 87290296 missense probably damaging 1.00
R1537:Ttc7 UTSW 17 87322463 missense possibly damaging 0.88
R1678:Ttc7 UTSW 17 87361901 missense probably damaging 1.00
R1747:Ttc7 UTSW 17 87307015 missense possibly damaging 0.87
R2146:Ttc7 UTSW 17 87346707 splice site probably benign
R3878:Ttc7 UTSW 17 87370738 intron probably benign
R3934:Ttc7 UTSW 17 87370738 intron probably benign
R4007:Ttc7 UTSW 17 87290251 missense possibly damaging 0.69
R4256:Ttc7 UTSW 17 87321401 critical splice acceptor site probably null
R4671:Ttc7 UTSW 17 87346620 missense probably damaging 1.00
R4676:Ttc7 UTSW 17 87370735 intron probably benign
R4677:Ttc7 UTSW 17 87370735 intron probably benign
R4784:Ttc7 UTSW 17 87340897 missense probably benign 0.03
R4833:Ttc7 UTSW 17 87334321 missense probably damaging 1.00
R4927:Ttc7 UTSW 17 87346705 splice site probably null
R4940:Ttc7 UTSW 17 87306958 missense probably benign 0.02
R5183:Ttc7 UTSW 17 87292878 missense probably damaging 1.00
R5634:Ttc7 UTSW 17 87342087 missense probably benign
R5710:Ttc7 UTSW 17 87290246 missense probably damaging 1.00
R5867:Ttc7 UTSW 17 87322472 missense possibly damaging 0.49
R6437:Ttc7 UTSW 17 87330106 missense probably damaging 1.00
R6982:Ttc7 UTSW 17 87307009 missense probably damaging 1.00
R7299:Ttc7 UTSW 17 87346542 missense possibly damaging 0.68
R7849:Ttc7 UTSW 17 87292946 missense probably null 0.00
R8098:Ttc7 UTSW 17 87334328 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TTCAAGGAGGGCAGCAACACTATG -3'
(R):5'- CGGGCTTCCAGATGAGTCTTTTCAG -3'

Sequencing Primer
(F):5'- CAGCAACACTATGGAGAGTTTC -3'
(R):5'- AGATGAGTCTTTTCAGCCAACC -3'
Posted On2014-04-24