Incidental Mutation 'R1586:Cidea'
ID177535
Institutional Source Beutler Lab
Gene Symbol Cidea
Ensembl Gene ENSMUSG00000024526
Gene Namecell death-inducing DNA fragmentation factor, alpha subunit-like effector A
Synonyms
MMRRC Submission 039623-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R1586 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location67343564-67367794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67360160 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 83 (V83E)
Ref Sequence ENSEMBL: ENSMUSP00000025404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025404]
Predicted Effect probably damaging
Transcript: ENSMUST00000025404
AA Change: V83E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025404
Gene: ENSMUSG00000024526
AA Change: V83E

DomainStartEndE-ValueType
CAD 35 108 9.62e-48 SMART
Meta Mutation Damage Score 0.1560 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 93% (65/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the mouse protein Cidea that has been shown to activate apoptosis. This activation of apoptosis is inhibited by the DNA fragmentation factor DFF45 but not by caspase inhibitors. Mice that lack functional Cidea have higher metabolic rates, higher lipolysis in brown adipose tissue and higher core body temperatures when subjected to cold. These mice are also resistant to diet-induced obesity and diabetes. This suggests that in mice this gene product plays a role in thermogenesis and lipolysis. Alternatively spliced transcripts have been identified. [provided by RefSeq, Aug 2010]
PHENOTYPE: Nullizygous mice show higher metabolic rate, lipolysis in BAT and core body temperature when subjected to cold treatment. They are lean and resistant to diet-induced obesity. Aging homozygotes exhibit dry eyes and hair, reduced sebaceous lipid secretion, hair loss, and poor water repulsion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,512 I282V probably benign Het
9030624J02Rik T A 7: 118,809,972 I612N probably damaging Het
Abca2 C T 2: 25,447,216 A2361V probably damaging Het
Alpi A G 1: 87,100,201 I219T probably damaging Het
Anapc10 T A 8: 79,775,143 M180K probably benign Het
Ank3 A G 10: 69,877,878 I431V probably damaging Het
Anxa8 T A 14: 34,093,937 D182E probably damaging Het
Atp1a3 T A 7: 24,979,383 I945F probably damaging Het
Atp2a3 T C 11: 72,991,744 S1019P probably damaging Het
Cbs T A 17: 31,622,474 I258F probably damaging Het
Cic T C 7: 25,285,961 S277P probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca3a2 A G 3: 144,810,716 I373T possibly damaging Het
Cpvl T A 6: 53,926,901 D293V probably damaging Het
Cryz A G 3: 154,611,510 N122S probably benign Het
Dmap1 T C 4: 117,676,122 E245G probably damaging Het
Epha2 C T 4: 141,318,605 probably benign Het
Fam222b C T 11: 78,154,521 L303F probably damaging Het
Fastkd1 T C 2: 69,712,148 D105G probably benign Het
Fat4 T A 3: 38,888,860 L634Q probably damaging Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fig4 A G 10: 41,265,427 F279L probably damaging Het
Guk1 A G 11: 59,186,849 S22P probably damaging Het
Kmt2d A G 15: 98,865,053 probably benign Het
Macf1 A T 4: 123,509,846 S727T probably benign Het
Mgea5 T G 19: 45,776,910 T153P possibly damaging Het
Mki67 T A 7: 135,713,972 K54* probably null Het
Ms4a8a T C 19: 11,076,332 T137A possibly damaging Het
Myo5c T C 9: 75,267,031 Y557H probably damaging Het
Nav3 T A 10: 109,853,254 K387N probably damaging Het
Olfr1432 G T 19: 12,228,877 A223E probably damaging Het
Pde4c T A 8: 70,746,859 Y223N probably damaging Het
Psd T G 19: 46,314,798 E715A probably damaging Het
Rpl7 A T 1: 16,102,583 S171T probably benign Het
Rrm1 A G 7: 102,466,905 *66W probably null Het
Scgb1b3 T A 7: 31,375,963 H79Q probably damaging Het
Serpinb9 A T 13: 33,015,486 M255L probably benign Het
Slc35a4 T C 18: 36,683,005 V296A probably benign Het
Smgc G A 15: 91,838,393 A9T possibly damaging Het
Snx11 C A 11: 96,770,696 W161L probably benign Het
Spag17 A G 3: 100,021,752 K533E possibly damaging Het
Speer4b A G 5: 27,497,013 S250P probably damaging Het
Spta1 A T 1: 174,213,495 H1287L probably benign Het
Surf2 T C 2: 26,919,755 F239S probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tbc1d22a C A 15: 86,351,651 probably null Het
Tbcd A G 11: 121,497,060 Q339R probably benign Het
Tdrd7 A G 4: 45,994,445 H281R probably benign Het
Tomm5 A G 4: 45,107,915 probably null Het
Ttc7 T C 17: 87,361,945 probably null Het
Ulk1 A T 5: 110,789,516 F638Y probably damaging Het
Wdr93 C A 7: 79,768,361 D277E probably damaging Het
Znrf3 T C 11: 5,281,477 R583G probably damaging Het
Zscan29 T A 2: 121,161,160 I716F probably damaging Het
Other mutations in Cidea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02164:Cidea APN 18 67366511 missense probably damaging 1.00
R1702:Cidea UTSW 18 67366421 missense probably damaging 1.00
R4559:Cidea UTSW 18 67360228 nonsense probably null
R4702:Cidea UTSW 18 67367428 missense probably benign 0.30
R5153:Cidea UTSW 18 67367420 missense probably damaging 1.00
R5384:Cidea UTSW 18 67360166 missense probably damaging 1.00
R6223:Cidea UTSW 18 67358739 missense possibly damaging 0.82
R7223:Cidea UTSW 18 67366421 missense probably damaging 1.00
R7593:Cidea UTSW 18 67360213 missense probably benign 0.00
R7866:Cidea UTSW 18 67358784 missense probably damaging 1.00
Z1176:Cidea UTSW 18 67358853 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CGCATAACAGGCAGTCGTGGAAAC -3'
(R):5'- CAGTGCTAAACCAGACAGTACGCTC -3'

Sequencing Primer
(F):5'- CTAGGGAGAGAGCACTCCATTC -3'
(R):5'- CAGTACGCTCATAGGTAGAATGTC -3'
Posted On2014-04-24