Incidental Mutation 'R1587:Olfr1161'
ID177545
Institutional Source Beutler Lab
Gene Symbol Olfr1161
Ensembl Gene ENSMUSG00000045150
Gene Nameolfactory receptor 1161
SynonymsMOR174-2, GA_x6K02T2Q125-49516664-49517629
MMRRC Submission 039624-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R1587 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88022774-88028252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88025133 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 137 (M137K)
Ref Sequence ENSEMBL: ENSMUSP00000150220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054845] [ENSMUST00000214438] [ENSMUST00000217006]
Predicted Effect probably damaging
Transcript: ENSMUST00000054845
AA Change: M137K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000060977
Gene: ENSMUSG00000045150
AA Change: M137K

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 8.8e-52 PFAM
Pfam:7tm_1 42 291 9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214438
AA Change: M137K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000217006
AA Change: M137K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,520 V355F probably damaging Het
A530064D06Rik A T 17: 48,166,417 S111T probably benign Het
Abhd2 A T 7: 79,354,010 H279L probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Agrn T C 4: 156,179,440 Q122R probably damaging Het
Arfgef1 A T 1: 10,159,959 F1218I probably damaging Het
Bud13 C T 9: 46,290,215 P395S probably damaging Het
Ccdc110 G A 8: 45,941,746 V225M probably benign Het
Ccdc30 A T 4: 119,353,176 S248T probably damaging Het
Cdh7 C A 1: 110,100,027 Q501K probably damaging Het
Cwc27 T C 13: 104,792,637 D266G probably benign Het
Cyp2d40 T A 15: 82,761,133 probably null Het
Cyp4a32 T G 4: 115,610,534 N238K probably benign Het
Ddx11 T C 17: 66,149,256 L770P probably damaging Het
Dgcr8 C T 16: 18,280,291 G412E probably damaging Het
Disp2 C A 2: 118,791,583 A932D probably damaging Het
Dlg4 T A 11: 70,031,746 N291K possibly damaging Het
Dnajc7 A G 11: 100,601,730 I39T probably damaging Het
Eno3 T C 11: 70,661,470 V316A probably damaging Het
Ep400 G A 5: 110,726,902 T944I probably benign Het
Ezh2 T G 6: 47,552,490 probably null Het
F7 A T 8: 13,034,783 I270F possibly damaging Het
Fancc A G 13: 63,340,432 F245L probably benign Het
Fzd7 G A 1: 59,483,006 C16Y possibly damaging Het
Gm29394 A G 15: 58,028,612 *200Q probably null Het
Ikbkap G A 4: 56,786,666 Q426* probably null Het
Ints8 A G 4: 11,245,722 probably null Het
Krt36 A T 11: 100,102,302 I449N probably damaging Het
Ldlr A T 9: 21,737,913 H328L probably damaging Het
Limk2 T C 11: 3,353,455 N101S possibly damaging Het
Lrp4 A G 2: 91,476,305 N321S probably benign Het
Mafk T C 5: 139,800,145 S33P probably damaging Het
Mbtps1 T C 8: 119,518,219 Y831C probably damaging Het
Mfge8 T A 7: 79,134,765 I344F probably damaging Het
Myo5b T C 18: 74,733,990 V1430A probably benign Het
Nbas G A 12: 13,558,685 R2154H probably benign Het
Nlrp6 G A 7: 140,923,046 R355H probably damaging Het
Noc4l T C 5: 110,653,023 T76A probably benign Het
Nrp1 T A 8: 128,476,282 C583S probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Pgm5 T A 19: 24,815,749 I318F probably damaging Het
Phf1 T A 17: 26,937,492 V536D probably damaging Het
Prpf4b C A 13: 34,892,150 A641D probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm47 A G 5: 66,024,991 I433T probably benign Het
S100a3 G A 3: 90,602,311 E88K probably benign Het
Sesn1 A G 10: 41,811,112 I31V probably benign Het
Son T A 16: 91,659,718 S1784R probably damaging Het
Srbd1 G T 17: 85,985,437 D901E probably damaging Het
St8sia6 C T 2: 13,672,605 D134N possibly damaging Het
Synpo2 T A 3: 123,114,398 D423V probably damaging Het
Vmn2r108 A G 17: 20,472,121 S158P probably damaging Het
Vmn2r109 A T 17: 20,540,740 V785E probably damaging Het
Zfp143 A G 7: 110,074,068 D124G probably benign Het
Zfp251 A G 15: 76,870,284 L54P probably damaging Het
Zfp324 G T 7: 12,970,643 S253I possibly damaging Het
Zfp59 A G 7: 27,854,134 E337G possibly damaging Het
Zfp663 G T 2: 165,353,517 Q261K probably benign Het
Zhx3 T C 2: 160,781,693 probably null Het
Other mutations in Olfr1161
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Olfr1161 APN 2 88025003 missense probably benign 0.23
IGL01564:Olfr1161 APN 2 88025304 missense probably benign 0.00
IGL01588:Olfr1161 APN 2 88025073 missense probably benign
R0268:Olfr1161 UTSW 2 88025468 missense probably damaging 0.99
R1995:Olfr1161 UTSW 2 88025672 missense probably benign 0.06
R2249:Olfr1161 UTSW 2 88025363 missense probably damaging 0.98
R3813:Olfr1161 UTSW 2 88024761 missense probably damaging 1.00
R4473:Olfr1161 UTSW 2 88025120 missense probably damaging 1.00
R4772:Olfr1161 UTSW 2 88024863 missense probably damaging 0.99
R4787:Olfr1161 UTSW 2 88024860 missense possibly damaging 0.79
R4870:Olfr1161 UTSW 2 88025460 missense probably damaging 1.00
R5260:Olfr1161 UTSW 2 88025474 missense probably benign 0.02
R5896:Olfr1161 UTSW 2 88025121 missense probably damaging 0.98
R6262:Olfr1161 UTSW 2 88025394 missense probably benign 0.00
R7330:Olfr1161 UTSW 2 88024921 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TGCTCCCAAGATGCTGGTGAATC -3'
(R):5'- AGAGGCCACTTTGAATGTGAGCTG -3'

Sequencing Primer
(F):5'- GCTATCTTTGTGGTAACTGAAACCA -3'
(R):5'- CACGTATAGAAAGCCTTTTGGCG -3'
Posted On2014-04-24