Mutagenetix > Incidental Mutation

Incidental Mutation 'R1587:Ep400'

177560

Institutional Source

Beutler Lab

Gene Symbol

Ep400

Ensembl Gene

ENSMUSG00000029505

Gene Name

E1A binding protein p400

Synonyms

mDomino, 1700020J09Rik, p400

MMRRC Submission

039624-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1587 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110664373-110770717 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 110726902 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 944 (T944I)

Ref Sequence

ENSEMBL: ENSMUSP00000108054 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112435] [ENSMUST00000112436]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000041558
AA Change: T907I

SMART Domains

Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: T907I

Domain	Start	End	E-Value	Type
Pfam:EP400_N	1	461	1.6e-232	PFAM
low complexity region	519	532	N/A	INTRINSIC
low complexity region	550	561	N/A	INTRINSIC
low complexity region	598	620	N/A	INTRINSIC
low complexity region	631	645	N/A	INTRINSIC
low complexity region	658	686	N/A	INTRINSIC
HSA	762	833	1.31e-31	SMART
low complexity region	908	925	N/A	INTRINSIC
DEXDc	1049	1238	2.76e-15	SMART
Blast:DEXDc	1276	1317	2e-15	BLAST
low complexity region	1407	1417	N/A	INTRINSIC
HELICc	1807	1893	1.17e-4	SMART
low complexity region	2006	2019	N/A	INTRINSIC
low complexity region	2080	2100	N/A	INTRINSIC
low complexity region	2214	2223	N/A	INTRINSIC
SANT	2243	2310	3.57e-1	SMART
low complexity region	2402	2489	N/A	INTRINSIC
low complexity region	2596	2608	N/A	INTRINSIC
low complexity region	2644	2679	N/A	INTRINSIC
low complexity region	2694	2738	N/A	INTRINSIC
low complexity region	2769	2806	N/A	INTRINSIC
low complexity region	2846	2883	N/A	INTRINSIC
low complexity region	2933	2947	N/A	INTRINSIC
low complexity region	2974	2986	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112435
AA Change: T944I

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505
AA Change: T944I

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
low complexity region	121	145	N/A	INTRINSIC
low complexity region	262	287	N/A	INTRINSIC
low complexity region	298	308	N/A	INTRINSIC
low complexity region	313	329	N/A	INTRINSIC
coiled coil region	418	447	N/A	INTRINSIC
low complexity region	471	485	N/A	INTRINSIC
low complexity region	556	569	N/A	INTRINSIC
low complexity region	587	598	N/A	INTRINSIC
low complexity region	635	657	N/A	INTRINSIC
low complexity region	668	682	N/A	INTRINSIC
low complexity region	695	723	N/A	INTRINSIC
HSA	799	870	1.31e-31	SMART
low complexity region	945	962	N/A	INTRINSIC
DEXDc	1086	1275	2.76e-15	SMART
Blast:DEXDc	1313	1354	2e-15	BLAST
low complexity region	1444	1454	N/A	INTRINSIC
internal_repeat_1	1556	1646	6.82e-5	PROSPERO
low complexity region	1887	1900	N/A	INTRINSIC
low complexity region	1961	1981	N/A	INTRINSIC
low complexity region	2095	2104	N/A	INTRINSIC
SANT	2124	2191	3.57e-1	SMART
low complexity region	2283	2370	N/A	INTRINSIC
internal_repeat_1	2371	2463	6.82e-5	PROSPERO
low complexity region	2477	2489	N/A	INTRINSIC
low complexity region	2525	2560	N/A	INTRINSIC
low complexity region	2575	2619	N/A	INTRINSIC
low complexity region	2645	2659	N/A	INTRINSIC
low complexity region	2660	2680	N/A	INTRINSIC
low complexity region	2720	2757	N/A	INTRINSIC
low complexity region	2807	2821	N/A	INTRINSIC
low complexity region	2848	2860	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000112436
AA Change: T871I

SMART Domains

Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: T871I

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
low complexity region	121	145	N/A	INTRINSIC
low complexity region	262	287	N/A	INTRINSIC
low complexity region	298	308	N/A	INTRINSIC
low complexity region	313	329	N/A	INTRINSIC
coiled coil region	418	449	N/A	INTRINSIC
low complexity region	472	482	N/A	INTRINSIC
low complexity region	483	496	N/A	INTRINSIC
low complexity region	514	525	N/A	INTRINSIC
low complexity region	562	584	N/A	INTRINSIC
low complexity region	595	609	N/A	INTRINSIC
low complexity region	622	650	N/A	INTRINSIC
HSA	726	797	1.31e-31	SMART
low complexity region	872	889	N/A	INTRINSIC
DEXDc	1013	1202	2.76e-15	SMART
Blast:DEXDc	1240	1281	2e-15	BLAST
low complexity region	1371	1381	N/A	INTRINSIC
internal_repeat_1	1483	1573	6.76e-5	PROSPERO
HELICc	1771	1857	1.17e-4	SMART
low complexity region	1970	1983	N/A	INTRINSIC
low complexity region	2044	2064	N/A	INTRINSIC
low complexity region	2178	2187	N/A	INTRINSIC
SANT	2207	2274	3.57e-1	SMART
low complexity region	2366	2453	N/A	INTRINSIC
internal_repeat_1	2454	2546	6.76e-5	PROSPERO
low complexity region	2560	2572	N/A	INTRINSIC
low complexity region	2608	2643	N/A	INTRINSIC
low complexity region	2658	2702	N/A	INTRINSIC
low complexity region	2733	2770	N/A	INTRINSIC
low complexity region	2810	2847	N/A	INTRINSIC
low complexity region	2897	2911	N/A	INTRINSIC
low complexity region	2938	2950	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.2%
20x: 88.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	G	T	6: 149,326,520	V355F	probably damaging	Het
A530064D06Rik	A	T	17: 48,166,417	S111T	probably benign	Het
Abhd2	A	T	7: 79,354,010	H279L	probably benign	Het
Ablim1	C	T	19: 57,083,547	M1I	probably null	Het
Agrn	T	C	4: 156,179,440	Q122R	probably damaging	Het
Arfgef1	A	T	1: 10,159,959	F1218I	probably damaging	Het
Bud13	C	T	9: 46,290,215	P395S	probably damaging	Het
Ccdc110	G	A	8: 45,941,746	V225M	probably benign	Het
Ccdc30	A	T	4: 119,353,176	S248T	probably damaging	Het
Cdh7	C	A	1: 110,100,027	Q501K	probably damaging	Het
Cwc27	T	C	13: 104,792,637	D266G	probably benign	Het
Cyp2d40	T	A	15: 82,761,133		probably null	Het
Cyp4a32	T	G	4: 115,610,534	N238K	probably benign	Het
Ddx11	T	C	17: 66,149,256	L770P	probably damaging	Het
Dgcr8	C	T	16: 18,280,291	G412E	probably damaging	Het
Disp2	C	A	2: 118,791,583	A932D	probably damaging	Het
Dlg4	T	A	11: 70,031,746	N291K	possibly damaging	Het
Dnajc7	A	G	11: 100,601,730	I39T	probably damaging	Het
Eno3	T	C	11: 70,661,470	V316A	probably damaging	Het
Ezh2	T	G	6: 47,552,490		probably null	Het
F7	A	T	8: 13,034,783	I270F	possibly damaging	Het
Fancc	A	G	13: 63,340,432	F245L	probably benign	Het
Fzd7	G	A	1: 59,483,006	C16Y	possibly damaging	Het
Gm29394	A	G	15: 58,028,612	*200Q	probably null	Het
Ikbkap	G	A	4: 56,786,666	Q426*	probably null	Het
Ints8	A	G	4: 11,245,722		probably null	Het
Krt36	A	T	11: 100,102,302	I449N	probably damaging	Het
Ldlr	A	T	9: 21,737,913	H328L	probably damaging	Het
Limk2	T	C	11: 3,353,455	N101S	possibly damaging	Het
Lrp4	A	G	2: 91,476,305	N321S	probably benign	Het
Mafk	T	C	5: 139,800,145	S33P	probably damaging	Het
Mbtps1	T	C	8: 119,518,219	Y831C	probably damaging	Het
Mfge8	T	A	7: 79,134,765	I344F	probably damaging	Het
Myo5b	T	C	18: 74,733,990	V1430A	probably benign	Het
Nbas	G	A	12: 13,558,685	R2154H	probably benign	Het
Nlrp6	G	A	7: 140,923,046	R355H	probably damaging	Het
Noc4l	T	C	5: 110,653,023	T76A	probably benign	Het
Nrp1	T	A	8: 128,476,282	C583S	probably damaging	Het
Olfr1161	T	A	2: 88,025,133	M137K	probably damaging	Het
Olfr1362	C	T	13: 21,611,913	D19N	probably benign	Het
Pgm5	T	A	19: 24,815,749	I318F	probably damaging	Het
Phf1	T	A	17: 26,937,492	V536D	probably damaging	Het
Prpf4b	C	A	13: 34,892,150	A641D	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm47	A	G	5: 66,024,991	I433T	probably benign	Het
S100a3	G	A	3: 90,602,311	E88K	probably benign	Het
Sesn1	A	G	10: 41,811,112	I31V	probably benign	Het
Son	T	A	16: 91,659,718	S1784R	probably damaging	Het
Srbd1	G	T	17: 85,985,437	D901E	probably damaging	Het
St8sia6	C	T	2: 13,672,605	D134N	possibly damaging	Het
Synpo2	T	A	3: 123,114,398	D423V	probably damaging	Het
Vmn2r108	A	G	17: 20,472,121	S158P	probably damaging	Het
Vmn2r109	A	T	17: 20,540,740	V785E	probably damaging	Het
Zfp143	A	G	7: 110,074,068	D124G	probably benign	Het
Zfp251	A	G	15: 76,870,284	L54P	probably damaging	Het
Zfp324	G	T	7: 12,970,643	S253I	possibly damaging	Het
Zfp59	A	G	7: 27,854,134	E337G	possibly damaging	Het
Zfp663	G	T	2: 165,353,517	Q261K	probably benign	Het
Zhx3	T	C	2: 160,781,693		probably null	Het

Other mutations in Ep400

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Ep400	APN	5	110687841	missense	unknown
IGL00585:Ep400	APN	5	110755905	missense	possibly damaging	0.70
IGL00586:Ep400	APN	5	110739594	missense	probably damaging	1.00
IGL00816:Ep400	APN	5	110735490	unclassified	probably benign
IGL01066:Ep400	APN	5	110668199	splice site	probably benign
IGL01302:Ep400	APN	5	110742048	missense	probably benign	0.00
IGL01568:Ep400	APN	5	110719495	missense	unknown
IGL01833:Ep400	APN	5	110680008	missense	unknown
IGL02086:Ep400	APN	5	110676943	splice site	probably benign
IGL02266:Ep400	APN	5	110695297	unclassified	probably benign
IGL02288:Ep400	APN	5	110683836	splice site	probably benign
IGL02301:Ep400	APN	5	110674960	missense	probably damaging	1.00
IGL02377:Ep400	APN	5	110720825	missense	unknown
IGL02382:Ep400	APN	5	110701728	missense	unknown
IGL02419:Ep400	APN	5	110697376	splice site	probably null
IGL02591:Ep400	APN	5	110733772	unclassified	probably benign
IGL02981:Ep400	APN	5	110756103	missense	possibly damaging	0.79
IGL02981:Ep400	APN	5	110691610	splice site	probably benign
IGL03173:Ep400	APN	5	110708871	unclassified	probably benign
IGL03244:Ep400	APN	5	110727563	missense	unknown
IGL03333:Ep400	APN	5	110703566	missense	unknown
santol	UTSW	5	110701671	missense	unknown
PIT4243001:Ep400	UTSW	5	110735580	missense	unknown
PIT4260001:Ep400	UTSW	5	110693171	nonsense	probably null
R0017:Ep400	UTSW	5	110673529	missense	probably damaging	1.00
R0179:Ep400	UTSW	5	110668649	missense	probably damaging	0.99
R0243:Ep400	UTSW	5	110724407	splice site	probably benign
R0366:Ep400	UTSW	5	110701671	missense	unknown
R0508:Ep400	UTSW	5	110739508	missense	probably benign	0.00
R0541:Ep400	UTSW	5	110705016	missense	unknown
R0558:Ep400	UTSW	5	110685067	splice site	probably benign
R0576:Ep400	UTSW	5	110711093	unclassified	probably benign
R0595:Ep400	UTSW	5	110703542	missense	unknown
R0671:Ep400	UTSW	5	110688196	missense	unknown
R0763:Ep400	UTSW	5	110665837	missense	probably damaging	1.00
R1078:Ep400	UTSW	5	110735522	unclassified	probably benign
R1300:Ep400	UTSW	5	110673560	missense	probably damaging	1.00
R1439:Ep400	UTSW	5	110685478	missense	unknown
R1520:Ep400	UTSW	5	110691778	intron	probably benign
R1529:Ep400	UTSW	5	110739445	missense	probably benign	0.00
R1535:Ep400	UTSW	5	110708166	unclassified	probably benign
R1560:Ep400	UTSW	5	110671106	splice site	probably null
R1596:Ep400	UTSW	5	110708861	unclassified	probably benign
R1653:Ep400	UTSW	5	110693174	nonsense	probably null
R1711:Ep400	UTSW	5	110693308	unclassified	probably benign
R1774:Ep400	UTSW	5	110685491	missense	unknown
R1836:Ep400	UTSW	5	110705054	missense	unknown
R1905:Ep400	UTSW	5	110670948	missense	probably damaging	1.00
R1917:Ep400	UTSW	5	110703575	missense	unknown
R2064:Ep400	UTSW	5	110735404	unclassified	probably benign
R2122:Ep400	UTSW	5	110708850	unclassified	probably benign
R2144:Ep400	UTSW	5	110703518	missense	unknown
R2215:Ep400	UTSW	5	110693555	unclassified	probably benign
R2252:Ep400	UTSW	5	110719091	missense	unknown
R2253:Ep400	UTSW	5	110719091	missense	unknown
R2483:Ep400	UTSW	5	110719236	missense	unknown
R2504:Ep400	UTSW	5	110668645	missense	probably damaging	1.00
R2512:Ep400	UTSW	5	110708915	unclassified	probably benign
R2842:Ep400	UTSW	5	110698815	nonsense	probably null
R2920:Ep400	UTSW	5	110755914	missense	probably damaging	1.00
R3082:Ep400	UTSW	5	110693230	unclassified	probably benign
R3151:Ep400	UTSW	5	110703569	missense	unknown
R3552:Ep400	UTSW	5	110729287	missense	unknown
R3623:Ep400	UTSW	5	110719236	missense	unknown
R3779:Ep400	UTSW	5	110691649	missense	unknown
R3923:Ep400	UTSW	5	110756523	missense	possibly damaging	0.55
R4062:Ep400	UTSW	5	110741981	missense	probably benign	0.10
R4508:Ep400	UTSW	5	110703615	missense	unknown
R4584:Ep400	UTSW	5	110733897	unclassified	probably benign
R4585:Ep400	UTSW	5	110753859	missense	probably damaging	1.00
R4586:Ep400	UTSW	5	110753859	missense	probably damaging	1.00
R4807:Ep400	UTSW	5	110695578	splice site	probably null
R4921:Ep400	UTSW	5	110665810	missense	probably damaging	1.00
R4976:Ep400	UTSW	5	110698812	missense	unknown
R4976:Ep400	UTSW	5	110720756	missense	unknown
R5075:Ep400	UTSW	5	110685485	missense	unknown
R5120:Ep400	UTSW	5	110756358	missense	probably damaging	1.00
R5122:Ep400	UTSW	5	110668170	missense	probably damaging	1.00
R5223:Ep400	UTSW	5	110668630	missense	probably damaging	1.00
R5284:Ep400	UTSW	5	110668124	missense	probably damaging	1.00
R5388:Ep400	UTSW	5	110701728	missense	unknown
R5401:Ep400	UTSW	5	110683171	missense	unknown
R5431:Ep400	UTSW	5	110676554	missense	unknown
R5461:Ep400	UTSW	5	110676684	nonsense	probably null
R5568:Ep400	UTSW	5	110756205	missense	probably damaging	1.00
R5650:Ep400	UTSW	5	110695952	critical splice donor site	probably null
R5778:Ep400	UTSW	5	110719584	missense	unknown
R5806:Ep400	UTSW	5	110755554	nonsense	probably null
R5814:Ep400	UTSW	5	110695578	splice site	probably null
R5830:Ep400	UTSW	5	110683996	missense	unknown
R5882:Ep400	UTSW	5	110755587	missense	probably benign	0.00
R5931:Ep400	UTSW	5	110735520	unclassified	probably benign
R5945:Ep400	UTSW	5	110682866	missense	unknown
R5966:Ep400	UTSW	5	110676900	missense	unknown
R5973:Ep400	UTSW	5	110729831	missense	unknown
R5980:Ep400	UTSW	5	110733729	unclassified	probably benign
R6000:Ep400	UTSW	5	110683201	missense	unknown
R6006:Ep400	UTSW	5	110704959	missense	unknown
R6053:Ep400	UTSW	5	110755795	missense	probably benign	0.22
R6145:Ep400	UTSW	5	110756703	missense	possibly damaging	0.95
R6154:Ep400	UTSW	5	110755933	missense	probably damaging	0.97
R6169:Ep400	UTSW	5	110741997	missense	possibly damaging	0.83
R6228:Ep400	UTSW	5	110670942	missense	probably damaging	1.00
R6295:Ep400	UTSW	5	110753809	missense	probably benign	0.00
R6486:Ep400	UTSW	5	110697218	unclassified	probably benign
R6504:Ep400	UTSW	5	110708837	unclassified	probably benign
R6607:Ep400	UTSW	5	110683314	missense	unknown
R6657:Ep400	UTSW	5	110693545	unclassified	probably benign
R6660:Ep400	UTSW	5	110719447	nonsense	probably null
R6741:Ep400	UTSW	5	110676895	missense	unknown
R6933:Ep400	UTSW	5	110665862	missense	probably damaging	1.00
R6937:Ep400	UTSW	5	110711152	unclassified	probably benign
R7069:Ep400	UTSW	5	110668124	missense	probably damaging	1.00
R7103:Ep400	UTSW	5	110733785	missense	unknown
R7156:Ep400	UTSW	5	110685363	missense	unknown
R7272:Ep400	UTSW	5	110755645	nonsense	probably null
R7365:Ep400	UTSW	5	110719614	missense	unknown
R7581:Ep400	UTSW	5	110756025	missense	unknown
R7684:Ep400	UTSW	5	110697352	missense	unknown
R7699:Ep400	UTSW	5	110696032	missense	unknown
R7700:Ep400	UTSW	5	110696032	missense	unknown
R7856:Ep400	UTSW	5	110666584	missense	probably damaging	0.99
R7954:Ep400	UTSW	5	110668733	missense	possibly damaging	0.46
R8098:Ep400	UTSW	5	110693251	missense	unknown
R8108:Ep400	UTSW	5	110687883	missense	unknown
R8260:Ep400	UTSW	5	110755612	nonsense	probably null
R8293:Ep400	UTSW	5	110708892	missense	unknown
R8314:Ep400	UTSW	5	110755753	missense	unknown
R8351:Ep400	UTSW	5	110739334	missense	probably damaging	1.00
R8424:Ep400	UTSW	5	110693278	missense	unknown
R8459:Ep400	UTSW	5	110708891	missense	unknown
R8529:Ep400	UTSW	5	110719236	missense	unknown
R8688:Ep400	UTSW	5	110720819	missense	unknown
R8744:Ep400	UTSW	5	110742059	missense	unknown
R8923:Ep400	UTSW	5	110683998	missense	unknown
R9005:Ep400	UTSW	5	110711093	missense	unknown
R9087:Ep400	UTSW	5	110667564	nonsense	probably null
R9146:Ep400	UTSW	5	110701769	nonsense	probably null
R9383:Ep400	UTSW	5	110685485	missense	unknown
R9479:Ep400	UTSW	5	110729864	missense	unknown
R9496:Ep400	UTSW	5	110707987	missense	unknown
R9582:Ep400	UTSW	5	110676449	critical splice donor site	probably null
R9607:Ep400	UTSW	5	110683939	missense	unknown
R9712:Ep400	UTSW	5	110756643	missense	unknown
R9746:Ep400	UTSW	5	110742006	missense	unknown
X0012:Ep400	UTSW	5	110673196	small deletion	probably benign
X0021:Ep400	UTSW	5	110682864	missense	unknown
Z1176:Ep400	UTSW	5	110756635	missense	unknown
Z1177:Ep400	UTSW	5	110683364	missense	unknown
Z1177:Ep400	UTSW	5	110733743	missense	unknown
Z1188:Ep400	UTSW	5	110755683	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CAGGATCAGAACTGGCCCTGAATC -3'
(R):5'- CATGGTGTTAGGATAGCCCAGCAG -3'

Sequencing Primer
(F):5'- cttagttcaattcccagcaacc -3'
(R):5'- AGCAGGTGTCCTGATGCTC -3'

Posted On

2014-04-24