Incidental Mutation 'R1587:Mafk'
ID177561
Institutional Source Beutler Lab
Gene Symbol Mafk
Ensembl Gene ENSMUSG00000018143
Gene Namev-maf musculoaponeurotic fibrosarcoma oncogene family, protein K (avian)
SynonymsNF-E2, p18 NF-E2, Nfe2u
MMRRC Submission 039624-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1587 (G1)
Quality Score199
Status Not validated
Chromosome5
Chromosomal Location139791513-139802653 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139800145 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 33 (S33P)
Ref Sequence ENSEMBL: ENSMUSP00000106460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018287] [ENSMUST00000044002] [ENSMUST00000110832] [ENSMUST00000110836]
Predicted Effect probably damaging
Transcript: ENSMUST00000018287
AA Change: S33P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018287
Gene: ENSMUSG00000018143
AA Change: S33P

DomainStartEndE-ValueType
BRLZ 49 113 1.83e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044002
SMART Domains Protein: ENSMUSP00000035399
Gene: ENSMUSG00000036687

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 46 54 N/A INTRINSIC
Pfam:Solute_trans_a 82 356 2.2e-93 PFAM
low complexity region 408 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110832
SMART Domains Protein: ENSMUSP00000106456
Gene: ENSMUSG00000036687

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
Pfam:Solute_trans_a 55 332 6.7e-101 PFAM
low complexity region 384 411 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110836
AA Change: S33P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106460
Gene: ENSMUSG00000018143
AA Change: S33P

DomainStartEndE-ValueType
BRLZ 49 113 1.83e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151577
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The developmentally regulated expression of the globin genes depends on upstream regulatory elements termed locus control regions (LCRs). LCRs are associated with powerful enhancer activity that is mediated by the transcription factor NFE2 (nuclear factor erythroid-2). NFE2 recognition sites are also present in the gene promoters of 2 heme biosynthetic enzymes, porphobilinogen deaminase (PBGD; MIM 609806) and ferrochelatase (FECH; MIM 612386). NFE2 DNA-binding activity consists of a heterodimer containing an 18-kD Maf protein (MafF, MafG (MIM 602020), or MafK) and p45 (MIM 601490). Both subunits are members of the activator protein-1 superfamily of basic leucine zipper (bZIP) proteins (see MIM 165160). Maf homodimers suppress transcription at NFE2 sites.[supplied by OMIM, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, healthy and phenotypically normal with no detectable erythroid deficiencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,520 V355F probably damaging Het
A530064D06Rik A T 17: 48,166,417 S111T probably benign Het
Abhd2 A T 7: 79,354,010 H279L probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Agrn T C 4: 156,179,440 Q122R probably damaging Het
Arfgef1 A T 1: 10,159,959 F1218I probably damaging Het
Bud13 C T 9: 46,290,215 P395S probably damaging Het
Ccdc110 G A 8: 45,941,746 V225M probably benign Het
Ccdc30 A T 4: 119,353,176 S248T probably damaging Het
Cdh7 C A 1: 110,100,027 Q501K probably damaging Het
Cwc27 T C 13: 104,792,637 D266G probably benign Het
Cyp2d40 T A 15: 82,761,133 probably null Het
Cyp4a32 T G 4: 115,610,534 N238K probably benign Het
Ddx11 T C 17: 66,149,256 L770P probably damaging Het
Dgcr8 C T 16: 18,280,291 G412E probably damaging Het
Disp2 C A 2: 118,791,583 A932D probably damaging Het
Dlg4 T A 11: 70,031,746 N291K possibly damaging Het
Dnajc7 A G 11: 100,601,730 I39T probably damaging Het
Eno3 T C 11: 70,661,470 V316A probably damaging Het
Ep400 G A 5: 110,726,902 T944I probably benign Het
Ezh2 T G 6: 47,552,490 probably null Het
F7 A T 8: 13,034,783 I270F possibly damaging Het
Fancc A G 13: 63,340,432 F245L probably benign Het
Fzd7 G A 1: 59,483,006 C16Y possibly damaging Het
Gm29394 A G 15: 58,028,612 *200Q probably null Het
Ikbkap G A 4: 56,786,666 Q426* probably null Het
Ints8 A G 4: 11,245,722 probably null Het
Krt36 A T 11: 100,102,302 I449N probably damaging Het
Ldlr A T 9: 21,737,913 H328L probably damaging Het
Limk2 T C 11: 3,353,455 N101S possibly damaging Het
Lrp4 A G 2: 91,476,305 N321S probably benign Het
Mbtps1 T C 8: 119,518,219 Y831C probably damaging Het
Mfge8 T A 7: 79,134,765 I344F probably damaging Het
Myo5b T C 18: 74,733,990 V1430A probably benign Het
Nbas G A 12: 13,558,685 R2154H probably benign Het
Nlrp6 G A 7: 140,923,046 R355H probably damaging Het
Noc4l T C 5: 110,653,023 T76A probably benign Het
Nrp1 T A 8: 128,476,282 C583S probably damaging Het
Olfr1161 T A 2: 88,025,133 M137K probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Pgm5 T A 19: 24,815,749 I318F probably damaging Het
Phf1 T A 17: 26,937,492 V536D probably damaging Het
Prpf4b C A 13: 34,892,150 A641D probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm47 A G 5: 66,024,991 I433T probably benign Het
S100a3 G A 3: 90,602,311 E88K probably benign Het
Sesn1 A G 10: 41,811,112 I31V probably benign Het
Son T A 16: 91,659,718 S1784R probably damaging Het
Srbd1 G T 17: 85,985,437 D901E probably damaging Het
St8sia6 C T 2: 13,672,605 D134N possibly damaging Het
Synpo2 T A 3: 123,114,398 D423V probably damaging Het
Vmn2r108 A G 17: 20,472,121 S158P probably damaging Het
Vmn2r109 A T 17: 20,540,740 V785E probably damaging Het
Zfp143 A G 7: 110,074,068 D124G probably benign Het
Zfp251 A G 15: 76,870,284 L54P probably damaging Het
Zfp324 G T 7: 12,970,643 S253I possibly damaging Het
Zfp59 A G 7: 27,854,134 E337G possibly damaging Het
Zfp663 G T 2: 165,353,517 Q261K probably benign Het
Zhx3 T C 2: 160,781,693 probably null Het
Other mutations in Mafk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Mafk APN 5 139800493 missense probably damaging 0.98
R3435:Mafk UTSW 5 139800307 nonsense probably null
R4694:Mafk UTSW 5 139800493 missense probably damaging 0.98
R6330:Mafk UTSW 5 139799193 missense probably benign 0.02
R7089:Mafk UTSW 5 139800121 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACCAAGACCTTCCTGAGGGAATG -3'
(R):5'- TCTGTAGGGCCTCATACTTGGAGC -3'

Sequencing Primer
(F):5'- CTCCCTGTTCAAAGAGGTGTCATAG -3'
(R):5'- TCATACTTGGAGCGCAGGG -3'
Posted On2014-04-24