Incidental Mutation 'R1587:Abhd2'
ID177569
Institutional Source Beutler Lab
Gene Symbol Abhd2
Ensembl Gene ENSMUSG00000039202
Gene Nameabhydrolase domain containing 2
SynonymsLABH2, 2210009N18Rik
MMRRC Submission 039624-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R1587 (G1)
Quality Score173
Status Not validated
Chromosome7
Chromosomal Location79273199-79365508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79354010 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 279 (H279L)
Ref Sequence ENSEMBL: ENSMUSP00000038361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037315]
Predicted Effect probably benign
Transcript: ENSMUST00000037315
AA Change: H279L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000038361
Gene: ENSMUSG00000039202
AA Change: H279L

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Pfam:Hydrolase_4 124 362 1.1e-10 PFAM
Pfam:Abhydrolase_1 126 383 2.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158828
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing an alpha/beta hydrolase fold, which is a catalytic domain found in a wide range of enzymes. The encoded protein is an acylglycerol lipase that catalyzes the hydrolysis of endocannabinoid arachidonoylglycerol from the cell membrane. This leads to activation of the sperm calcium channel CatSper, which results in sperm activation. Alternative splicing of this gene results in two transcript variants encoding the same protein. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a gene trapped allele are overtly but exhibit enhanced migratory ability of cultured smooth muscle cells, and significant intimal hyperplasia after cuff placement. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,520 V355F probably damaging Het
A530064D06Rik A T 17: 48,166,417 S111T probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Agrn T C 4: 156,179,440 Q122R probably damaging Het
Arfgef1 A T 1: 10,159,959 F1218I probably damaging Het
Bud13 C T 9: 46,290,215 P395S probably damaging Het
Ccdc110 G A 8: 45,941,746 V225M probably benign Het
Ccdc30 A T 4: 119,353,176 S248T probably damaging Het
Cdh7 C A 1: 110,100,027 Q501K probably damaging Het
Cwc27 T C 13: 104,792,637 D266G probably benign Het
Cyp2d40 T A 15: 82,761,133 probably null Het
Cyp4a32 T G 4: 115,610,534 N238K probably benign Het
Ddx11 T C 17: 66,149,256 L770P probably damaging Het
Dgcr8 C T 16: 18,280,291 G412E probably damaging Het
Disp2 C A 2: 118,791,583 A932D probably damaging Het
Dlg4 T A 11: 70,031,746 N291K possibly damaging Het
Dnajc7 A G 11: 100,601,730 I39T probably damaging Het
Eno3 T C 11: 70,661,470 V316A probably damaging Het
Ep400 G A 5: 110,726,902 T944I probably benign Het
Ezh2 T G 6: 47,552,490 probably null Het
F7 A T 8: 13,034,783 I270F possibly damaging Het
Fancc A G 13: 63,340,432 F245L probably benign Het
Fzd7 G A 1: 59,483,006 C16Y possibly damaging Het
Gm29394 A G 15: 58,028,612 *200Q probably null Het
Ikbkap G A 4: 56,786,666 Q426* probably null Het
Ints8 A G 4: 11,245,722 probably null Het
Krt36 A T 11: 100,102,302 I449N probably damaging Het
Ldlr A T 9: 21,737,913 H328L probably damaging Het
Limk2 T C 11: 3,353,455 N101S possibly damaging Het
Lrp4 A G 2: 91,476,305 N321S probably benign Het
Mafk T C 5: 139,800,145 S33P probably damaging Het
Mbtps1 T C 8: 119,518,219 Y831C probably damaging Het
Mfge8 T A 7: 79,134,765 I344F probably damaging Het
Myo5b T C 18: 74,733,990 V1430A probably benign Het
Nbas G A 12: 13,558,685 R2154H probably benign Het
Nlrp6 G A 7: 140,923,046 R355H probably damaging Het
Noc4l T C 5: 110,653,023 T76A probably benign Het
Nrp1 T A 8: 128,476,282 C583S probably damaging Het
Olfr1161 T A 2: 88,025,133 M137K probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Pgm5 T A 19: 24,815,749 I318F probably damaging Het
Phf1 T A 17: 26,937,492 V536D probably damaging Het
Prpf4b C A 13: 34,892,150 A641D probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm47 A G 5: 66,024,991 I433T probably benign Het
S100a3 G A 3: 90,602,311 E88K probably benign Het
Sesn1 A G 10: 41,811,112 I31V probably benign Het
Son T A 16: 91,659,718 S1784R probably damaging Het
Srbd1 G T 17: 85,985,437 D901E probably damaging Het
St8sia6 C T 2: 13,672,605 D134N possibly damaging Het
Synpo2 T A 3: 123,114,398 D423V probably damaging Het
Vmn2r108 A G 17: 20,472,121 S158P probably damaging Het
Vmn2r109 A T 17: 20,540,740 V785E probably damaging Het
Zfp143 A G 7: 110,074,068 D124G probably benign Het
Zfp251 A G 15: 76,870,284 L54P probably damaging Het
Zfp324 G T 7: 12,970,643 S253I possibly damaging Het
Zfp59 A G 7: 27,854,134 E337G possibly damaging Het
Zfp663 G T 2: 165,353,517 Q261K probably benign Het
Zhx3 T C 2: 160,781,693 probably null Het
Other mutations in Abhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Abhd2 APN 7 79325452 missense possibly damaging 0.91
IGL03067:Abhd2 APN 7 79360034 missense probably benign
R0363:Abhd2 UTSW 7 79350813 missense possibly damaging 0.81
R1921:Abhd2 UTSW 7 79348356 missense possibly damaging 0.83
R3108:Abhd2 UTSW 7 79323585 missense probably benign 0.01
R4374:Abhd2 UTSW 7 79323530 missense probably benign 0.00
R4621:Abhd2 UTSW 7 79325487 missense probably damaging 1.00
R4763:Abhd2 UTSW 7 79360131 missense probably benign 0.00
R5217:Abhd2 UTSW 7 79323630 missense probably benign
R5599:Abhd2 UTSW 7 79296998 splice site probably null
R6972:Abhd2 UTSW 7 79354027 missense probably benign 0.02
R7617:Abhd2 UTSW 7 79348284 missense probably benign 0.10
R8062:Abhd2 UTSW 7 79325590 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCTGATTTACTGTACTGCTTGGTCCCAT -3'
(R):5'- CCACTCAGTTCAAGCTGCCACAT -3'

Sequencing Primer
(F):5'- CATGGCAACTGGTACTCCTG -3'
(R):5'- TTCCAAGAGATGAGAATTTCCCCG -3'
Posted On2014-04-24