Mutagenetix > Incidental Mutation

Incidental Mutation 'R1587:Nlrp6'

177572

Institutional Source

Beutler Lab

Gene Symbol

Nlrp6

Ensembl Gene

ENSMUSG00000038745

Gene Name

NLR family, pyrin domain containing 6

Synonyms

Nalp6

MMRRC Submission

039624-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R1587 (G1)

Quality Score

193

Status

Not validated

Chromosome

Chromosomal Location

140920902-140929192 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 140923046 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 355 (R355H)

Ref Sequence

ENSEMBL: ENSMUSP00000139170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]

AlphaFold

Q91WS2

Predicted Effect

probably damaging
Transcript: ENSMUST00000106045
AA Change: R325H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745
AA Change: R325H

Domain	Start	End	E-Value	Type
PYRIN	15	96	5.44e-27	SMART
low complexity region	158	169	N/A	INTRINSIC
Pfam:NACHT	194	363	8.6e-44	PFAM
coiled coil region	590	617	N/A	INTRINSIC
low complexity region	675	697	N/A	INTRINSIC
internal_repeat_1	715	763	9.43e-6	PROSPERO
internal_repeat_1	828	876	9.43e-6	PROSPERO

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183761

Predicted Effect

probably damaging
Transcript: ENSMUST00000183845
AA Change: R325H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745
AA Change: R325H

Domain	Start	End	E-Value	Type
PYRIN	15	96	5.44e-27	SMART
low complexity region	158	169	N/A	INTRINSIC
Pfam:NACHT	194	363	5.5e-43	PFAM
coiled coil region	590	617	N/A	INTRINSIC
low complexity region	680	694	N/A	INTRINSIC
internal_repeat_1	702	750	1.26e-5	PROSPERO
internal_repeat_1	815	863	1.26e-5	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000184560
AA Change: R355H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745
AA Change: R355H

Domain	Start	End	E-Value	Type
PYRIN	45	126	5.44e-27	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:NACHT	224	393	8.2e-43	PFAM
coiled coil region	620	647	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
internal_repeat_1	732	780	1.55e-5	PROSPERO
internal_repeat_1	845	893	1.55e-5	PROSPERO

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.2%
20x: 88.9%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	G	T	6: 149,326,520	V355F	probably damaging	Het
A530064D06Rik	A	T	17: 48,166,417	S111T	probably benign	Het
Abhd2	A	T	7: 79,354,010	H279L	probably benign	Het
Ablim1	C	T	19: 57,083,547	M1I	probably null	Het
Agrn	T	C	4: 156,179,440	Q122R	probably damaging	Het
Arfgef1	A	T	1: 10,159,959	F1218I	probably damaging	Het
Bud13	C	T	9: 46,290,215	P395S	probably damaging	Het
Ccdc110	G	A	8: 45,941,746	V225M	probably benign	Het
Ccdc30	A	T	4: 119,353,176	S248T	probably damaging	Het
Cdh7	C	A	1: 110,100,027	Q501K	probably damaging	Het
Cwc27	T	C	13: 104,792,637	D266G	probably benign	Het
Cyp2d40	T	A	15: 82,761,133		probably null	Het
Cyp4a32	T	G	4: 115,610,534	N238K	probably benign	Het
Ddx11	T	C	17: 66,149,256	L770P	probably damaging	Het
Dgcr8	C	T	16: 18,280,291	G412E	probably damaging	Het
Disp2	C	A	2: 118,791,583	A932D	probably damaging	Het
Dlg4	T	A	11: 70,031,746	N291K	possibly damaging	Het
Dnajc7	A	G	11: 100,601,730	I39T	probably damaging	Het
Eno3	T	C	11: 70,661,470	V316A	probably damaging	Het
Ep400	G	A	5: 110,726,902	T944I	probably benign	Het
Ezh2	T	G	6: 47,552,490		probably null	Het
F7	A	T	8: 13,034,783	I270F	possibly damaging	Het
Fancc	A	G	13: 63,340,432	F245L	probably benign	Het
Fzd7	G	A	1: 59,483,006	C16Y	possibly damaging	Het
Gm29394	A	G	15: 58,028,612	*200Q	probably null	Het
Ikbkap	G	A	4: 56,786,666	Q426*	probably null	Het
Ints8	A	G	4: 11,245,722		probably null	Het
Krt36	A	T	11: 100,102,302	I449N	probably damaging	Het
Ldlr	A	T	9: 21,737,913	H328L	probably damaging	Het
Limk2	T	C	11: 3,353,455	N101S	possibly damaging	Het
Lrp4	A	G	2: 91,476,305	N321S	probably benign	Het
Mafk	T	C	5: 139,800,145	S33P	probably damaging	Het
Mbtps1	T	C	8: 119,518,219	Y831C	probably damaging	Het
Mfge8	T	A	7: 79,134,765	I344F	probably damaging	Het
Myo5b	T	C	18: 74,733,990	V1430A	probably benign	Het
Nbas	G	A	12: 13,558,685	R2154H	probably benign	Het
Noc4l	T	C	5: 110,653,023	T76A	probably benign	Het
Nrp1	T	A	8: 128,476,282	C583S	probably damaging	Het
Olfr1161	T	A	2: 88,025,133	M137K	probably damaging	Het
Olfr1362	C	T	13: 21,611,913	D19N	probably benign	Het
Pgm5	T	A	19: 24,815,749	I318F	probably damaging	Het
Phf1	T	A	17: 26,937,492	V536D	probably damaging	Het
Prpf4b	C	A	13: 34,892,150	A641D	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm47	A	G	5: 66,024,991	I433T	probably benign	Het
S100a3	G	A	3: 90,602,311	E88K	probably benign	Het
Sesn1	A	G	10: 41,811,112	I31V	probably benign	Het
Son	T	A	16: 91,659,718	S1784R	probably damaging	Het
Srbd1	G	T	17: 85,985,437	D901E	probably damaging	Het
St8sia6	C	T	2: 13,672,605	D134N	possibly damaging	Het
Synpo2	T	A	3: 123,114,398	D423V	probably damaging	Het
Vmn2r108	A	G	17: 20,472,121	S158P	probably damaging	Het
Vmn2r109	A	T	17: 20,540,740	V785E	probably damaging	Het
Zfp143	A	G	7: 110,074,068	D124G	probably benign	Het
Zfp251	A	G	15: 76,870,284	L54P	probably damaging	Het
Zfp324	G	T	7: 12,970,643	S253I	possibly damaging	Het
Zfp59	A	G	7: 27,854,134	E337G	possibly damaging	Het
Zfp663	G	T	2: 165,353,517	Q261K	probably benign	Het
Zhx3	T	C	2: 160,781,693		probably null	Het

Other mutations in Nlrp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Nlrp6	APN	7	140923124	missense	probably damaging	1.00
IGL01066:Nlrp6	APN	7	140921796	missense	possibly damaging	0.88
IGL01966:Nlrp6	APN	7	140925190	missense	probably damaging	1.00
IGL02625:Nlrp6	APN	7	140923500	missense	probably benign	0.00
IGL02792:Nlrp6	APN	7	140922435	missense	probably damaging	0.97
IGL02813:Nlrp6	APN	7	140923420	missense	possibly damaging	0.86
IGL03140:Nlrp6	APN	7	140927487	missense	probably benign	0.01
R0608:Nlrp6	UTSW	7	140923486	nonsense	probably null
R1404:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R1404:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R1472:Nlrp6	UTSW	7	140923495	missense	probably damaging	1.00
R1843:Nlrp6	UTSW	7	140923093	missense	probably damaging	1.00
R1959:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R2097:Nlrp6	UTSW	7	140923204	missense	probably damaging	1.00
R2118:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2119:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2120:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2121:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2290:Nlrp6	UTSW	7	140922163	missense	probably damaging	1.00
R3546:Nlrp6	UTSW	7	140926769	missense	probably benign	0.00
R3547:Nlrp6	UTSW	7	140926769	missense	probably benign	0.00
R3970:Nlrp6	UTSW	7	140921655	missense	probably damaging	1.00
R4483:Nlrp6	UTSW	7	140921781	missense	probably damaging	1.00
R4484:Nlrp6	UTSW	7	140921781	missense	probably damaging	1.00
R4869:Nlrp6	UTSW	7	140924093	missense	probably damaging	1.00
R4962:Nlrp6	UTSW	7	140923584	missense	probably damaging	0.99
R5436:Nlrp6	UTSW	7	140922717	nonsense	probably null
R5442:Nlrp6	UTSW	7	140922190	missense	probably benign	0.01
R5924:Nlrp6	UTSW	7	140923490	missense	probably damaging	1.00
R5936:Nlrp6	UTSW	7	140922812	nonsense	probably null
R6124:Nlrp6	UTSW	7	140923247	missense	probably damaging	1.00
R6455:Nlrp6	UTSW	7	140927509	missense	possibly damaging	0.65
R6480:Nlrp6	UTSW	7	140927443	missense	possibly damaging	0.93
R6873:Nlrp6	UTSW	7	140923520	missense	probably benign	0.01
R7061:Nlrp6	UTSW	7	140922867	missense	probably benign	0.36
R7350:Nlrp6	UTSW	7	140921278	start gained	probably benign
R7532:Nlrp6	UTSW	7	140925184	missense	probably benign	0.00
R7752:Nlrp6	UTSW	7	140927440	missense	possibly damaging	0.92
R7901:Nlrp6	UTSW	7	140927440	missense	possibly damaging	0.92
R8098:Nlrp6	UTSW	7	140923255	missense	probably damaging	1.00
R8381:Nlrp6	UTSW	7	140923841	missense	possibly damaging	0.47
R8513:Nlrp6	UTSW	7	140922830	missense	possibly damaging	0.83
R9114:Nlrp6	UTSW	7	140926419	missense	probably damaging	1.00
V7732:Nlrp6	UTSW	7	140926648	splice site	probably benign
Z1176:Nlrp6	UTSW	7	140922721	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCAGCAGGTAAGCTATACCACAG -3'
(R):5'- TCTCTTTCACGAAGCGGTAAGCG -3'

Sequencing Primer
(F):5'- ACAGCCAGGTGGACTTTG -3'
(R):5'- GCGCTCTGCCTTCCTCTC -3'

Posted On

2014-04-24