Incidental Mutation 'R1587:Dnajc7'
ID177587
Institutional Source Beutler Lab
Gene Symbol Dnajc7
Ensembl Gene ENSMUSG00000014195
Gene NameDnaJ heat shock protein family (Hsp40) member C7
SynonymsmTpr2, Ttc2, 2010003F24Rik, mDj11, 2010004G07Rik
MMRRC Submission 039624-MU
Accession Numbers

Genbank: NM_019795; MGI: 1928373

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1587 (G1)
Quality Score214
Status Not validated
Chromosome11
Chromosomal Location100582818-100620168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100601730 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 39 (I39T)
Ref Sequence ENSEMBL: ENSMUSP00000115438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014339] [ENSMUST00000146840]
Predicted Effect probably damaging
Transcript: ENSMUST00000014339
AA Change: I55T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000014339
Gene: ENSMUSG00000014195
AA Change: I55T

DomainStartEndE-ValueType
TPR 28 61 3.39e-7 SMART
TPR 62 95 1.11e-2 SMART
TPR 96 129 4.09e-1 SMART
Blast:TPR 142 175 4e-13 BLAST
Blast:TPR 176 209 1e-13 BLAST
TPR 210 243 2.29e-4 SMART
TPR 256 289 1.11e-2 SMART
TPR 294 327 2.87e-5 SMART
TPR 328 361 1.83e-3 SMART
DnaJ 380 443 2.93e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137688
Predicted Effect probably damaging
Transcript: ENSMUST00000146840
AA Change: I39T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115438
Gene: ENSMUSG00000014195
AA Change: I39T

DomainStartEndE-ValueType
TPR 12 45 3.39e-7 SMART
TPR 46 79 1.11e-2 SMART
TPR 80 113 4.09e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154972
Predicted Effect unknown
Transcript: ENSMUST00000155152
AA Change: I45T
SMART Domains Protein: ENSMUSP00000116793
Gene: ENSMUSG00000014195
AA Change: I45T

DomainStartEndE-ValueType
TPR 19 52 3.39e-7 SMART
TPR 53 86 1.11e-2 SMART
Blast:TPR 95 128 1e-13 BLAST
Blast:TPR 129 162 3e-14 BLAST
TPR 163 196 2.29e-4 SMART
TPR 209 242 1.11e-2 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ heat shock protein 40 family of proteins that is characterized by two N-terminal tetratricopeptide repeat domains and a C-terminal DNAJ domain. This protein binds the chaperone proteins heat shock proteins 70 and 90 in an ATP-dependent manner and may function as a co-chaperone. Pseudogenes of this gene are found on chromosomes 1 and 6. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit hepatic steatosis and increased serum cholesterol. [provided by MGI curators]
Allele List at MGI

All alleles(178) : Targeted, other(2) Gene trapped(176)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,520 V355F probably damaging Het
A530064D06Rik A T 17: 48,166,417 S111T probably benign Het
Abhd2 A T 7: 79,354,010 H279L probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Agrn T C 4: 156,179,440 Q122R probably damaging Het
Arfgef1 A T 1: 10,159,959 F1218I probably damaging Het
Bud13 C T 9: 46,290,215 P395S probably damaging Het
Ccdc110 G A 8: 45,941,746 V225M probably benign Het
Ccdc30 A T 4: 119,353,176 S248T probably damaging Het
Cdh7 C A 1: 110,100,027 Q501K probably damaging Het
Cwc27 T C 13: 104,792,637 D266G probably benign Het
Cyp2d40 T A 15: 82,761,133 probably null Het
Cyp4a32 T G 4: 115,610,534 N238K probably benign Het
Ddx11 T C 17: 66,149,256 L770P probably damaging Het
Dgcr8 C T 16: 18,280,291 G412E probably damaging Het
Disp2 C A 2: 118,791,583 A932D probably damaging Het
Dlg4 T A 11: 70,031,746 N291K possibly damaging Het
Eno3 T C 11: 70,661,470 V316A probably damaging Het
Ep400 G A 5: 110,726,902 T944I probably benign Het
Ezh2 T G 6: 47,552,490 probably null Het
F7 A T 8: 13,034,783 I270F possibly damaging Het
Fancc A G 13: 63,340,432 F245L probably benign Het
Fzd7 G A 1: 59,483,006 C16Y possibly damaging Het
Gm29394 A G 15: 58,028,612 *200Q probably null Het
Ikbkap G A 4: 56,786,666 Q426* probably null Het
Ints8 A G 4: 11,245,722 probably null Het
Krt36 A T 11: 100,102,302 I449N probably damaging Het
Ldlr A T 9: 21,737,913 H328L probably damaging Het
Limk2 T C 11: 3,353,455 N101S possibly damaging Het
Lrp4 A G 2: 91,476,305 N321S probably benign Het
Mafk T C 5: 139,800,145 S33P probably damaging Het
Mbtps1 T C 8: 119,518,219 Y831C probably damaging Het
Mfge8 T A 7: 79,134,765 I344F probably damaging Het
Myo5b T C 18: 74,733,990 V1430A probably benign Het
Nbas G A 12: 13,558,685 R2154H probably benign Het
Nlrp6 G A 7: 140,923,046 R355H probably damaging Het
Noc4l T C 5: 110,653,023 T76A probably benign Het
Nrp1 T A 8: 128,476,282 C583S probably damaging Het
Olfr1161 T A 2: 88,025,133 M137K probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Pgm5 T A 19: 24,815,749 I318F probably damaging Het
Phf1 T A 17: 26,937,492 V536D probably damaging Het
Prpf4b C A 13: 34,892,150 A641D probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm47 A G 5: 66,024,991 I433T probably benign Het
S100a3 G A 3: 90,602,311 E88K probably benign Het
Sesn1 A G 10: 41,811,112 I31V probably benign Het
Son T A 16: 91,659,718 S1784R probably damaging Het
Srbd1 G T 17: 85,985,437 D901E probably damaging Het
St8sia6 C T 2: 13,672,605 D134N possibly damaging Het
Synpo2 T A 3: 123,114,398 D423V probably damaging Het
Vmn2r108 A G 17: 20,472,121 S158P probably damaging Het
Vmn2r109 A T 17: 20,540,740 V785E probably damaging Het
Zfp143 A G 7: 110,074,068 D124G probably benign Het
Zfp251 A G 15: 76,870,284 L54P probably damaging Het
Zfp324 G T 7: 12,970,643 S253I possibly damaging Het
Zfp59 A G 7: 27,854,134 E337G possibly damaging Het
Zfp663 G T 2: 165,353,517 Q261K probably benign Het
Zhx3 T C 2: 160,781,693 probably null Het
Other mutations in Dnajc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Dnajc7 APN 11 100599191 missense possibly damaging 0.90
IGL00924:Dnajc7 APN 11 100584285 missense possibly damaging 0.81
3-1:Dnajc7 UTSW 11 100589957 missense probably damaging 1.00
R1282:Dnajc7 UTSW 11 100584641 missense probably damaging 1.00
R1874:Dnajc7 UTSW 11 100599313 splice site probably benign
R1985:Dnajc7 UTSW 11 100590892 missense probably benign 0.11
R4020:Dnajc7 UTSW 11 100591466 missense probably damaging 0.96
R4065:Dnajc7 UTSW 11 100601781 missense probably benign 0.00
R4067:Dnajc7 UTSW 11 100601781 missense probably benign 0.00
R4611:Dnajc7 UTSW 11 100590977 nonsense probably null
R4687:Dnajc7 UTSW 11 100599300 missense probably damaging 1.00
R4716:Dnajc7 UTSW 11 100619576 missense probably benign
R7469:Dnajc7 UTSW 11 100591551 missense probably benign
R7740:Dnajc7 UTSW 11 100591561 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGAAGCACCAATCATTGGATGCAAG -3'
(R):5'- CACCCCATGTGTAGGATTGTAGGC -3'

Sequencing Primer
(F):5'- CCAATCATTGGATGCAAGTGTTG -3'
(R):5'- agtttttttgtctcagcttctcc -3'
Posted On2014-04-24