Incidental Mutation 'R1587:Prpf4b'
Institutional Source Beutler Lab
Gene Symbol Prpf4b
Ensembl Gene ENSMUSG00000021413
Gene Namepre-mRNA processing factor 4B
SynonymsPrp4, Prp4k, Prpk
MMRRC Submission 039624-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1587 (G1)
Quality Score225
Status Not validated
Chromosomal Location34875302-34906064 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34892150 bp
Amino Acid Change Alanine to Aspartic acid at position 641 (A641D)
Ref Sequence ENSEMBL: ENSMUSP00000152654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077853] [ENSMUST00000222509]
Predicted Effect probably benign
Transcript: ENSMUST00000077853
AA Change: A641D

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000077019
Gene: ENSMUSG00000021413
AA Change: A641D

low complexity region 40 62 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 102 123 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 156 170 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
low complexity region 210 233 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
low complexity region 299 324 N/A INTRINSIC
low complexity region 340 360 N/A INTRINSIC
low complexity region 390 417 N/A INTRINSIC
low complexity region 435 497 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
S_TKc 687 1003 4.99e-74 SMART
Predicted Effect unknown
Transcript: ENSMUST00000220965
AA Change: A144D
Predicted Effect unknown
Transcript: ENSMUST00000221077
AA Change: A9D
Predicted Effect probably benign
Transcript: ENSMUST00000222509
AA Change: A641D

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in two sequential transesterification steps, and the protein encoded by this gene is thought to be involved in pre-mRNA splicing and in signal transduction. This protein belongs to a kinase family that includes serine/arginine-rich protein-specific kinases and cyclin-dependent kinases (CDKs). This protein is regarded as a CDK-like kinase (Clk) with homology to mitogen-activated protein kinases (MAPKs). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,520 V355F probably damaging Het
A530064D06Rik A T 17: 48,166,417 S111T probably benign Het
Abhd2 A T 7: 79,354,010 H279L probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Agrn T C 4: 156,179,440 Q122R probably damaging Het
Arfgef1 A T 1: 10,159,959 F1218I probably damaging Het
Bud13 C T 9: 46,290,215 P395S probably damaging Het
Ccdc110 G A 8: 45,941,746 V225M probably benign Het
Ccdc30 A T 4: 119,353,176 S248T probably damaging Het
Cdh7 C A 1: 110,100,027 Q501K probably damaging Het
Cwc27 T C 13: 104,792,637 D266G probably benign Het
Cyp2d40 T A 15: 82,761,133 probably null Het
Cyp4a32 T G 4: 115,610,534 N238K probably benign Het
Ddx11 T C 17: 66,149,256 L770P probably damaging Het
Dgcr8 C T 16: 18,280,291 G412E probably damaging Het
Disp2 C A 2: 118,791,583 A932D probably damaging Het
Dlg4 T A 11: 70,031,746 N291K possibly damaging Het
Dnajc7 A G 11: 100,601,730 I39T probably damaging Het
Eno3 T C 11: 70,661,470 V316A probably damaging Het
Ep400 G A 5: 110,726,902 T944I probably benign Het
Ezh2 T G 6: 47,552,490 probably null Het
F7 A T 8: 13,034,783 I270F possibly damaging Het
Fancc A G 13: 63,340,432 F245L probably benign Het
Fzd7 G A 1: 59,483,006 C16Y possibly damaging Het
Gm29394 A G 15: 58,028,612 *200Q probably null Het
Ikbkap G A 4: 56,786,666 Q426* probably null Het
Ints8 A G 4: 11,245,722 probably null Het
Krt36 A T 11: 100,102,302 I449N probably damaging Het
Ldlr A T 9: 21,737,913 H328L probably damaging Het
Limk2 T C 11: 3,353,455 N101S possibly damaging Het
Lrp4 A G 2: 91,476,305 N321S probably benign Het
Mafk T C 5: 139,800,145 S33P probably damaging Het
Mbtps1 T C 8: 119,518,219 Y831C probably damaging Het
Mfge8 T A 7: 79,134,765 I344F probably damaging Het
Myo5b T C 18: 74,733,990 V1430A probably benign Het
Nbas G A 12: 13,558,685 R2154H probably benign Het
Nlrp6 G A 7: 140,923,046 R355H probably damaging Het
Noc4l T C 5: 110,653,023 T76A probably benign Het
Nrp1 T A 8: 128,476,282 C583S probably damaging Het
Olfr1161 T A 2: 88,025,133 M137K probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Pgm5 T A 19: 24,815,749 I318F probably damaging Het
Phf1 T A 17: 26,937,492 V536D probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm47 A G 5: 66,024,991 I433T probably benign Het
S100a3 G A 3: 90,602,311 E88K probably benign Het
Sesn1 A G 10: 41,811,112 I31V probably benign Het
Son T A 16: 91,659,718 S1784R probably damaging Het
Srbd1 G T 17: 85,985,437 D901E probably damaging Het
St8sia6 C T 2: 13,672,605 D134N possibly damaging Het
Synpo2 T A 3: 123,114,398 D423V probably damaging Het
Vmn2r108 A G 17: 20,472,121 S158P probably damaging Het
Vmn2r109 A T 17: 20,540,740 V785E probably damaging Het
Zfp143 A G 7: 110,074,068 D124G probably benign Het
Zfp251 A G 15: 76,870,284 L54P probably damaging Het
Zfp324 G T 7: 12,970,643 S253I possibly damaging Het
Zfp59 A G 7: 27,854,134 E337G possibly damaging Het
Zfp663 G T 2: 165,353,517 Q261K probably benign Het
Zhx3 T C 2: 160,781,693 probably null Het
Other mutations in Prpf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Prpf4b APN 13 34883907 missense probably benign 0.23
IGL00639:Prpf4b APN 13 34899173 missense possibly damaging 0.70
IGL00901:Prpf4b APN 13 34894482 missense probably damaging 1.00
IGL01301:Prpf4b APN 13 34884291 missense probably benign 0.23
IGL02027:Prpf4b APN 13 34889571 missense probably benign 0.35
IGL02111:Prpf4b APN 13 34883961 missense probably benign 0.23
IGL02256:Prpf4b APN 13 34899878 missense probably damaging 0.98
IGL02590:Prpf4b APN 13 34888146 unclassified probably benign
IGL03389:Prpf4b APN 13 34900456 splice site probably benign
IGL03411:Prpf4b APN 13 34895359 missense probably damaging 1.00
ANU18:Prpf4b UTSW 13 34884291 missense probably benign 0.23
PIT4260001:Prpf4b UTSW 13 34884291 missense probably benign 0.23
PIT4696001:Prpf4b UTSW 13 34899842 missense probably benign 0.01
R0114:Prpf4b UTSW 13 34890488 splice site probably benign
R0157:Prpf4b UTSW 13 34884031 unclassified probably benign
R1551:Prpf4b UTSW 13 34894443 missense possibly damaging 0.91
R2105:Prpf4b UTSW 13 34884231 unclassified probably benign
R2152:Prpf4b UTSW 13 34900419 missense probably benign 0.04
R2432:Prpf4b UTSW 13 34883341 unclassified probably benign
R3802:Prpf4b UTSW 13 34883682 unclassified probably benign
R3803:Prpf4b UTSW 13 34883682 unclassified probably benign
R3804:Prpf4b UTSW 13 34883682 unclassified probably benign
R3982:Prpf4b UTSW 13 34884213 unclassified probably benign
R4603:Prpf4b UTSW 13 34888164 unclassified probably benign
R4633:Prpf4b UTSW 13 34900442 missense probably damaging 1.00
R4649:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R4651:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R4653:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R5022:Prpf4b UTSW 13 34883599 unclassified probably benign
R5028:Prpf4b UTSW 13 34899975 missense probably damaging 1.00
R5232:Prpf4b UTSW 13 34883590 unclassified probably benign
R5313:Prpf4b UTSW 13 34894549 missense probably damaging 1.00
R5440:Prpf4b UTSW 13 34884093 unclassified probably benign
R5511:Prpf4b UTSW 13 34884054 unclassified probably benign
R5863:Prpf4b UTSW 13 34899128 missense possibly damaging 0.51
R5981:Prpf4b UTSW 13 34886710 missense probably benign 0.23
R6360:Prpf4b UTSW 13 34901433 missense probably damaging 0.99
R6398:Prpf4b UTSW 13 34900371 missense probably damaging 1.00
R6556:Prpf4b UTSW 13 34896032 missense probably damaging 0.98
R6880:Prpf4b UTSW 13 34894453 missense possibly damaging 0.69
R7133:Prpf4b UTSW 13 34901494 missense probably benign 0.02
R7148:Prpf4b UTSW 13 34894472 missense probably benign 0.04
R7208:Prpf4b UTSW 13 34884011 missense unknown
RF002:Prpf4b UTSW 13 34884236 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tgtttttcaagtcaggctttctc -3'
Posted On2014-04-24