Incidental Mutation 'R1587:Son'
ID177599
Institutional Source Beutler Lab
Gene Symbol Son
Ensembl Gene ENSMUSG00000022961
Gene NameSon DNA binding protein
Synonyms2900011L12Rik
MMRRC Submission 039624-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R1587 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location91647506-91679221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91659718 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1784 (S1784R)
Ref Sequence ENSEMBL: ENSMUSP00000112453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000122302] [ENSMUST00000140312]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114036
AA Change: S1784R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961
AA Change: S1784R

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.65e-7 PROSPERO
internal_repeat_2 214 362 6.55e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.65e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.55e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114037
AA Change: S1784R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961
AA Change: S1784R

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.71e-7 PROSPERO
internal_repeat_2 214 362 7.05e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.71e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 7.05e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
G_patch 2321 2367 1.15e-17 SMART
Pfam:DND1_DSRM 2388 2442 5.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117633
AA Change: S1784R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961
AA Change: S1784R

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.59e-7 PROSPERO
internal_repeat_2 214 362 6.63e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.59e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.63e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
Pfam:RSRP 1909 2216 1e-12 PFAM
G_patch 2321 2367 1.15e-17 SMART
DSRM 2390 2458 5.37e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119368
AA Change: S1784R

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961
AA Change: S1784R

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.22e-7 PROSPERO
internal_repeat_2 214 362 8.67e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.22e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 8.67e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122302
SMART Domains Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 159 165 N/A INTRINSIC
G_patch 331 377 1.15e-17 SMART
Pfam:DND1_DSRM 398 452 7.9e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133589
Predicted Effect probably damaging
Transcript: ENSMUST00000140312
AA Change: S1784R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961
AA Change: S1784R

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.93e-7 PROSPERO
internal_repeat_2 214 362 1.1e-5 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.93e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 1.1e-5 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147891
SMART Domains Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
Pfam:RSRP 61 358 2.9e-13 PFAM
low complexity region 466 477 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,520 V355F probably damaging Het
A530064D06Rik A T 17: 48,166,417 S111T probably benign Het
Abhd2 A T 7: 79,354,010 H279L probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Agrn T C 4: 156,179,440 Q122R probably damaging Het
Arfgef1 A T 1: 10,159,959 F1218I probably damaging Het
Bud13 C T 9: 46,290,215 P395S probably damaging Het
Ccdc110 G A 8: 45,941,746 V225M probably benign Het
Ccdc30 A T 4: 119,353,176 S248T probably damaging Het
Cdh7 C A 1: 110,100,027 Q501K probably damaging Het
Cwc27 T C 13: 104,792,637 D266G probably benign Het
Cyp2d40 T A 15: 82,761,133 probably null Het
Cyp4a32 T G 4: 115,610,534 N238K probably benign Het
Ddx11 T C 17: 66,149,256 L770P probably damaging Het
Dgcr8 C T 16: 18,280,291 G412E probably damaging Het
Disp2 C A 2: 118,791,583 A932D probably damaging Het
Dlg4 T A 11: 70,031,746 N291K possibly damaging Het
Dnajc7 A G 11: 100,601,730 I39T probably damaging Het
Eno3 T C 11: 70,661,470 V316A probably damaging Het
Ep400 G A 5: 110,726,902 T944I probably benign Het
Ezh2 T G 6: 47,552,490 probably null Het
F7 A T 8: 13,034,783 I270F possibly damaging Het
Fancc A G 13: 63,340,432 F245L probably benign Het
Fzd7 G A 1: 59,483,006 C16Y possibly damaging Het
Gm29394 A G 15: 58,028,612 *200Q probably null Het
Ikbkap G A 4: 56,786,666 Q426* probably null Het
Ints8 A G 4: 11,245,722 probably null Het
Krt36 A T 11: 100,102,302 I449N probably damaging Het
Ldlr A T 9: 21,737,913 H328L probably damaging Het
Limk2 T C 11: 3,353,455 N101S possibly damaging Het
Lrp4 A G 2: 91,476,305 N321S probably benign Het
Mafk T C 5: 139,800,145 S33P probably damaging Het
Mbtps1 T C 8: 119,518,219 Y831C probably damaging Het
Mfge8 T A 7: 79,134,765 I344F probably damaging Het
Myo5b T C 18: 74,733,990 V1430A probably benign Het
Nbas G A 12: 13,558,685 R2154H probably benign Het
Nlrp6 G A 7: 140,923,046 R355H probably damaging Het
Noc4l T C 5: 110,653,023 T76A probably benign Het
Nrp1 T A 8: 128,476,282 C583S probably damaging Het
Olfr1161 T A 2: 88,025,133 M137K probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Pgm5 T A 19: 24,815,749 I318F probably damaging Het
Phf1 T A 17: 26,937,492 V536D probably damaging Het
Prpf4b C A 13: 34,892,150 A641D probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm47 A G 5: 66,024,991 I433T probably benign Het
S100a3 G A 3: 90,602,311 E88K probably benign Het
Sesn1 A G 10: 41,811,112 I31V probably benign Het
Srbd1 G T 17: 85,985,437 D901E probably damaging Het
St8sia6 C T 2: 13,672,605 D134N possibly damaging Het
Synpo2 T A 3: 123,114,398 D423V probably damaging Het
Vmn2r108 A G 17: 20,472,121 S158P probably damaging Het
Vmn2r109 A T 17: 20,540,740 V785E probably damaging Het
Zfp143 A G 7: 110,074,068 D124G probably benign Het
Zfp251 A G 15: 76,870,284 L54P probably damaging Het
Zfp324 G T 7: 12,970,643 S253I possibly damaging Het
Zfp59 A G 7: 27,854,134 E337G possibly damaging Het
Zfp663 G T 2: 165,353,517 Q261K probably benign Het
Zhx3 T C 2: 160,781,693 probably null Het
Other mutations in Son
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Son APN 16 91664322 missense probably damaging 0.99
IGL01024:Son APN 16 91655910 missense probably damaging 1.00
IGL01066:Son APN 16 91660136 intron probably benign
IGL01083:Son APN 16 91657391 missense probably damaging 1.00
IGL01115:Son APN 16 91659458 missense probably benign 0.31
IGL01467:Son APN 16 91657277 missense possibly damaging 0.93
IGL01506:Son APN 16 91657286 missense possibly damaging 0.67
IGL01933:Son APN 16 91658015 missense probably benign 0.00
IGL02156:Son APN 16 91656104 missense possibly damaging 0.93
IGL02473:Son APN 16 91658795 missense probably damaging 0.99
IGL02498:Son APN 16 91656825 missense probably damaging 0.99
IGL02517:Son APN 16 91655211 missense possibly damaging 0.92
IGL02530:Son APN 16 91658471 missense possibly damaging 0.50
IGL02865:Son APN 16 91651752 missense probably damaging 1.00
IGL03180:Son APN 16 91657008 missense probably damaging 1.00
R0013:Son UTSW 16 91651662 missense probably damaging 1.00
R0036:Son UTSW 16 91660166 intron probably benign
R0037:Son UTSW 16 91664728 missense probably damaging 1.00
R0041:Son UTSW 16 91659333 missense probably damaging 1.00
R0048:Son UTSW 16 91658977 missense possibly damaging 0.94
R0048:Son UTSW 16 91658977 missense possibly damaging 0.94
R0056:Son UTSW 16 91678155 missense possibly damaging 0.86
R0227:Son UTSW 16 91656873 missense probably damaging 0.99
R0256:Son UTSW 16 91656584 missense possibly damaging 0.95
R0302:Son UTSW 16 91656144 missense probably damaging 1.00
R0815:Son UTSW 16 91655484 missense probably damaging 0.98
R1225:Son UTSW 16 91657340 missense probably damaging 1.00
R1255:Son UTSW 16 91664695 missense probably damaging 1.00
R1457:Son UTSW 16 91657086 missense probably damaging 1.00
R1459:Son UTSW 16 91655342 missense possibly damaging 0.93
R1535:Son UTSW 16 91659734 missense probably damaging 0.99
R1605:Son UTSW 16 91657664 missense probably damaging 1.00
R1629:Son UTSW 16 91657622 missense probably damaging 1.00
R1711:Son UTSW 16 91660226 intron probably benign
R2138:Son UTSW 16 91659372 missense possibly damaging 0.95
R2245:Son UTSW 16 91647960 unclassified probably null
R2351:Son UTSW 16 91657659 missense probably damaging 0.98
R2434:Son UTSW 16 91654687 missense probably damaging 1.00
R2870:Son UTSW 16 91664317 unclassified probably null
R2871:Son UTSW 16 91664317 unclassified probably null
R2872:Son UTSW 16 91664317 unclassified probably null
R2889:Son UTSW 16 91659899 unclassified probably benign
R3712:Son UTSW 16 91656726 missense probably damaging 0.99
R3913:Son UTSW 16 91660111 intron probably benign
R4172:Son UTSW 16 91659362 missense probably damaging 1.00
R4301:Son UTSW 16 91658411 missense possibly damaging 0.53
R4302:Son UTSW 16 91658411 missense possibly damaging 0.53
R4770:Son UTSW 16 91658868 missense probably damaging 0.96
R4881:Son UTSW 16 91675509 missense probably benign 0.31
R5020:Son UTSW 16 91656375 missense probably damaging 1.00
R5032:Son UTSW 16 91657664 missense probably damaging 1.00
R5151:Son UTSW 16 91655699 missense probably damaging 1.00
R5153:Son UTSW 16 91655022 missense possibly damaging 0.86
R5215:Son UTSW 16 91656675 missense probably damaging 0.99
R5243:Son UTSW 16 91654733 missense probably damaging 1.00
R5354:Son UTSW 16 91655739 missense probably damaging 0.99
R5529:Son UTSW 16 91655466 missense probably damaging 1.00
R5696:Son UTSW 16 91671413 missense possibly damaging 0.67
R5763:Son UTSW 16 91657490 missense probably damaging 1.00
R5766:Son UTSW 16 91664987 intron probably benign
R5788:Son UTSW 16 91660052 intron probably benign
R5992:Son UTSW 16 91658904 missense probably benign 0.04
R6314:Son UTSW 16 91660410 intron probably benign
R6371:Son UTSW 16 91674741
R6429:Son UTSW 16 91658166 missense probably benign 0.33
R6451:Son UTSW 16 91657602 missense probably damaging 0.99
R6489:Son UTSW 16 91655156 missense possibly damaging 0.70
R6513:Son UTSW 16 91659947 intron probably benign
R6753:Son UTSW 16 91657188 missense probably damaging 0.99
R6916:Son UTSW 16 91654785 missense probably damaging 0.97
R7070:Son UTSW 16 91656841 unclassified probably benign
R7079:Son UTSW 16 91656841 unclassified probably benign
R7110:Son UTSW 16 91656518 missense probably benign 0.01
R7120:Son UTSW 16 91656691 unclassified probably benign
R7120:Son UTSW 16 91670526 missense unknown
R7167:Son UTSW 16 91660334 small deletion probably benign
R7205:Son UTSW 16 91660295 small deletion probably benign
R7208:Son UTSW 16 91662102 missense unknown
R7219:Son UTSW 16 91665001 missense unknown
R7249:Son UTSW 16 91660334 small deletion probably benign
R7328:Son UTSW 16 91658390 missense probably benign 0.33
R7330:Son UTSW 16 91656598 unclassified probably benign
R7374:Son UTSW 16 91660334 small deletion probably benign
R7405:Son UTSW 16 91656691 unclassified probably benign
R7420:Son UTSW 16 91660334 small deletion probably benign
R7424:Son UTSW 16 91660334 small deletion probably benign
R7464:Son UTSW 16 91656691 unclassified probably benign
R7514:Son UTSW 16 91654860 missense probably damaging 0.99
R7555:Son UTSW 16 91658922 missense probably damaging 0.99
R7645:Son UTSW 16 91660295 small deletion probably benign
R7716:Son UTSW 16 91656691 unclassified probably benign
R7718:Son UTSW 16 91660334 small deletion probably benign
R7778:Son UTSW 16 91656528 missense probably damaging 0.99
R7824:Son UTSW 16 91656528 missense probably damaging 0.99
R7856:Son UTSW 16 91659258 missense probably damaging 0.99
R7870:Son UTSW 16 91656598 unclassified probably benign
R7939:Son UTSW 16 91659258 missense probably damaging 0.99
R8000:Son UTSW 16 91660334 small deletion probably benign
RF007:Son UTSW 16 91659369 missense possibly damaging 0.53
RF041:Son UTSW 16 91656691 unclassified probably benign
Z1176:Son UTSW 16 91655801 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CTATCAAAGAGAGTGCCCAGGCAG -3'
(R):5'- TCCGAGACCGTAATGAAGAGTCCC -3'

Sequencing Primer
(F):5'- CAGTGGCTCTTAGCCCTAAAG -3'
(R):5'- GTAATGAAGAGTCCCTTTTCTTCTC -3'
Posted On2014-04-24