Mutagenetix > Incidental Mutation

Incidental Mutation 'R1587:Vmn2r109'

177601

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r109

Ensembl Gene

ENSMUSG00000090572

Gene Name

vomeronasal 2, receptor 109

Synonyms

EG627814

MMRRC Submission

039624-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R1587 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20540517-20564756 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20540740 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 785 (V785E)

Ref Sequence

ENSEMBL: ENSMUSP00000132641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167093]

AlphaFold

K7N747

Predicted Effect

probably damaging
Transcript: ENSMUST00000167093
AA Change: V785E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: V785E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	83	467	1.4e-35	PFAM
Pfam:NCD3G	510	563	3.1e-21	PFAM
Pfam:7tm_3	596	831	7.4e-52	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.2%
20x: 88.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	G	T	6: 149,326,520	V355F	probably damaging	Het
A530064D06Rik	A	T	17: 48,166,417	S111T	probably benign	Het
Abhd2	A	T	7: 79,354,010	H279L	probably benign	Het
Ablim1	C	T	19: 57,083,547	M1I	probably null	Het
Agrn	T	C	4: 156,179,440	Q122R	probably damaging	Het
Arfgef1	A	T	1: 10,159,959	F1218I	probably damaging	Het
Bud13	C	T	9: 46,290,215	P395S	probably damaging	Het
Ccdc110	G	A	8: 45,941,746	V225M	probably benign	Het
Ccdc30	A	T	4: 119,353,176	S248T	probably damaging	Het
Cdh7	C	A	1: 110,100,027	Q501K	probably damaging	Het
Cwc27	T	C	13: 104,792,637	D266G	probably benign	Het
Cyp2d40	T	A	15: 82,761,133		probably null	Het
Cyp4a32	T	G	4: 115,610,534	N238K	probably benign	Het
Ddx11	T	C	17: 66,149,256	L770P	probably damaging	Het
Dgcr8	C	T	16: 18,280,291	G412E	probably damaging	Het
Disp2	C	A	2: 118,791,583	A932D	probably damaging	Het
Dlg4	T	A	11: 70,031,746	N291K	possibly damaging	Het
Dnajc7	A	G	11: 100,601,730	I39T	probably damaging	Het
Eno3	T	C	11: 70,661,470	V316A	probably damaging	Het
Ep400	G	A	5: 110,726,902	T944I	probably benign	Het
Ezh2	T	G	6: 47,552,490		probably null	Het
F7	A	T	8: 13,034,783	I270F	possibly damaging	Het
Fancc	A	G	13: 63,340,432	F245L	probably benign	Het
Fzd7	G	A	1: 59,483,006	C16Y	possibly damaging	Het
Gm29394	A	G	15: 58,028,612	*200Q	probably null	Het
Ikbkap	G	A	4: 56,786,666	Q426*	probably null	Het
Ints8	A	G	4: 11,245,722		probably null	Het
Krt36	A	T	11: 100,102,302	I449N	probably damaging	Het
Ldlr	A	T	9: 21,737,913	H328L	probably damaging	Het
Limk2	T	C	11: 3,353,455	N101S	possibly damaging	Het
Lrp4	A	G	2: 91,476,305	N321S	probably benign	Het
Mafk	T	C	5: 139,800,145	S33P	probably damaging	Het
Mbtps1	T	C	8: 119,518,219	Y831C	probably damaging	Het
Mfge8	T	A	7: 79,134,765	I344F	probably damaging	Het
Myo5b	T	C	18: 74,733,990	V1430A	probably benign	Het
Nbas	G	A	12: 13,558,685	R2154H	probably benign	Het
Nlrp6	G	A	7: 140,923,046	R355H	probably damaging	Het
Noc4l	T	C	5: 110,653,023	T76A	probably benign	Het
Nrp1	T	A	8: 128,476,282	C583S	probably damaging	Het
Olfr1161	T	A	2: 88,025,133	M137K	probably damaging	Het
Olfr1362	C	T	13: 21,611,913	D19N	probably benign	Het
Pgm5	T	A	19: 24,815,749	I318F	probably damaging	Het
Phf1	T	A	17: 26,937,492	V536D	probably damaging	Het
Prpf4b	C	A	13: 34,892,150	A641D	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm47	A	G	5: 66,024,991	I433T	probably benign	Het
S100a3	G	A	3: 90,602,311	E88K	probably benign	Het
Sesn1	A	G	10: 41,811,112	I31V	probably benign	Het
Son	T	A	16: 91,659,718	S1784R	probably damaging	Het
Srbd1	G	T	17: 85,985,437	D901E	probably damaging	Het
St8sia6	C	T	2: 13,672,605	D134N	possibly damaging	Het
Synpo2	T	A	3: 123,114,398	D423V	probably damaging	Het
Vmn2r108	A	G	17: 20,472,121	S158P	probably damaging	Het
Zfp143	A	G	7: 110,074,068	D124G	probably benign	Het
Zfp251	A	G	15: 76,870,284	L54P	probably damaging	Het
Zfp324	G	T	7: 12,970,643	S253I	possibly damaging	Het
Zfp59	A	G	7: 27,854,134	E337G	possibly damaging	Het
Zfp663	G	T	2: 165,353,517	Q261K	probably benign	Het
Zhx3	T	C	2: 160,781,693		probably null	Het

Other mutations in Vmn2r109

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01313:Vmn2r109	APN	17	20550157	missense	probably damaging	1.00
IGL01383:Vmn2r109	APN	17	20541121	missense	possibly damaging	0.89
IGL01469:Vmn2r109	APN	17	20541409	missense	probably damaging	1.00
IGL01762:Vmn2r109	APN	17	20554392	missense	probably benign
IGL01864:Vmn2r109	APN	17	20541134	missense	probably benign	0.28
IGL02028:Vmn2r109	APN	17	20541080	missense	probably benign	0.28
IGL02074:Vmn2r109	APN	17	20554341	missense	probably benign	0.05
IGL02162:Vmn2r109	APN	17	20554160	missense	probably benign	0.01
IGL02474:Vmn2r109	APN	17	20540888	missense	probably benign
IGL02490:Vmn2r109	APN	17	20540984	missense	possibly damaging	0.78
IGL02604:Vmn2r109	APN	17	20540701	missense	probably damaging	1.00
IGL02669:Vmn2r109	APN	17	20554256	missense	possibly damaging	0.64
IGL02705:Vmn2r109	APN	17	20553800	missense	probably benign
IGL02745:Vmn2r109	APN	17	20541250	missense	probably damaging	0.99
PIT4142001:Vmn2r109	UTSW	17	20554577	critical splice acceptor site	probably null
R0389:Vmn2r109	UTSW	17	20541074	missense	probably damaging	1.00
R0470:Vmn2r109	UTSW	17	20552886	missense	probably benign	0.06
R0570:Vmn2r109	UTSW	17	20540675	missense	probably damaging	0.99
R0855:Vmn2r109	UTSW	17	20541408	nonsense	probably null
R0882:Vmn2r109	UTSW	17	20554580	splice site	probably benign
R1241:Vmn2r109	UTSW	17	20555241	missense	possibly damaging	0.86
R1931:Vmn2r109	UTSW	17	20553810	nonsense	probably null
R1957:Vmn2r109	UTSW	17	20564707	missense	probably benign	0.11
R1962:Vmn2r109	UTSW	17	20553923	missense	probably damaging	0.99
R2020:Vmn2r109	UTSW	17	20541186	nonsense	probably null
R2073:Vmn2r109	UTSW	17	20564712	missense	probably benign	0.00
R2436:Vmn2r109	UTSW	17	20554536	missense	probably damaging	0.99
R3123:Vmn2r109	UTSW	17	20540986	missense	probably damaging	1.00
R3839:Vmn2r109	UTSW	17	20554442	missense	probably damaging	1.00
R4019:Vmn2r109	UTSW	17	20553812	missense	probably benign
R4428:Vmn2r109	UTSW	17	20553024	missense	probably benign
R4584:Vmn2r109	UTSW	17	20554558	nonsense	probably null
R4652:Vmn2r109	UTSW	17	20541394	missense	probably damaging	1.00
R4708:Vmn2r109	UTSW	17	20541343	missense	probably damaging	0.97
R4823:Vmn2r109	UTSW	17	20553891	missense	probably damaging	1.00
R4831:Vmn2r109	UTSW	17	20541232	missense	probably benign	0.01
R4907:Vmn2r109	UTSW	17	20550086	missense	probably damaging	1.00
R5011:Vmn2r109	UTSW	17	20555189	missense	probably damaging	1.00
R5296:Vmn2r109	UTSW	17	20554341	missense	possibly damaging	0.90
R5600:Vmn2r109	UTSW	17	20540927	missense	probably damaging	1.00
R5602:Vmn2r109	UTSW	17	20540671	missense	possibly damaging	0.94
R5652:Vmn2r109	UTSW	17	20540519	makesense	probably null
R5702:Vmn2r109	UTSW	17	20554145	missense	probably benign	0.42
R5706:Vmn2r109	UTSW	17	20554305	missense	probably benign	0.16
R5714:Vmn2r109	UTSW	17	20552859	missense	probably damaging	1.00
R5832:Vmn2r109	UTSW	17	20541056	missense	probably benign	0.10
R6008:Vmn2r109	UTSW	17	20540719	missense	probably damaging	1.00
R6334:Vmn2r109	UTSW	17	20541178	missense	probably benign	0.18
R6377:Vmn2r109	UTSW	17	20564534	critical splice donor site	probably null
R6738:Vmn2r109	UTSW	17	20554523	missense	possibly damaging	0.52
R6857:Vmn2r109	UTSW	17	20540670	missense	probably benign	0.45
R6953:Vmn2r109	UTSW	17	20540711	missense	possibly damaging	0.95
R7108:Vmn2r109	UTSW	17	20564744	missense	probably benign	0.03
R7229:Vmn2r109	UTSW	17	20540963	missense	possibly damaging	0.80
R7238:Vmn2r109	UTSW	17	20541074	missense	probably damaging	1.00
R7244:Vmn2r109	UTSW	17	20540683	missense	possibly damaging	0.70
R7292:Vmn2r109	UTSW	17	20541438	missense	probably benign	0.05
R7354:Vmn2r109	UTSW	17	20540781	missense	probably damaging	1.00
R7357:Vmn2r109	UTSW	17	20541274	missense	probably damaging	1.00
R7522:Vmn2r109	UTSW	17	20554403	missense	probably benign	0.11
R7596:Vmn2r109	UTSW	17	20540680	missense	probably damaging	0.98
R7728:Vmn2r109	UTSW	17	20552855	missense	probably damaging	0.99
R7859:Vmn2r109	UTSW	17	20541174	missense	probably damaging	1.00
R7871:Vmn2r109	UTSW	17	20540520	missense	probably benign	0.08
R8113:Vmn2r109	UTSW	17	20554467	missense	probably benign	0.01
R8153:Vmn2r109	UTSW	17	20564707	missense	probably benign	0.11
R8977:Vmn2r109	UTSW	17	20554269	missense	possibly damaging	0.96
R9687:Vmn2r109	UTSW	17	20555070	missense
Z1176:Vmn2r109	UTSW	17	20552994	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGGTTTGATGCCACCAATTCATAGACTC -3'
(R):5'- TCATGCTGAACATGGACAAATCCTACTG -3'

Sequencing Primer
(F):5'- AATTCATAGACTCAAAGAAGTTGAGG -3'
(R):5'- CCTACTGTTTTGCAACAAGGG -3'

Posted On

2014-04-24