Incidental Mutation 'R1587:Ddx11'
ID177604
Institutional Source Beutler Lab
Gene Symbol Ddx11
Ensembl Gene ENSMUSG00000035842
Gene NameDEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
SynonymsCHL1, 4732462I11Rik, CHLR1, essa15a, KRG2
MMRRC Submission 039624-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1587 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location66123520-66152174 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66149256 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 770 (L770P)
Ref Sequence ENSEMBL: ENSMUSP00000153436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163605] [ENSMUST00000224497] [ENSMUST00000224903]
Predicted Effect probably damaging
Transcript: ENSMUST00000163605
AA Change: L744P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130440
Gene: ENSMUSG00000035842
AA Change: L744P

DomainStartEndE-ValueType
DEXDc 11 408 1.14e-153 SMART
Blast:DEXDc2 430 479 6e-14 BLAST
HELICc 682 839 1.4e-66 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224497
AA Change: L770P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226095
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is an enzyme that possesses both ATPase and DNA helicase activities. This gene is a homolog of the yeast CHL1 gene, and may function to maintain chromosome transmission fidelity and genome stability. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality before E11.5 with growth retardation, failure of chorioallantoic fusion, poor placental labyrinth development, and embryonic cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,520 V355F probably damaging Het
A530064D06Rik A T 17: 48,166,417 S111T probably benign Het
Abhd2 A T 7: 79,354,010 H279L probably benign Het
Ablim1 C T 19: 57,083,547 M1I probably null Het
Agrn T C 4: 156,179,440 Q122R probably damaging Het
Arfgef1 A T 1: 10,159,959 F1218I probably damaging Het
Bud13 C T 9: 46,290,215 P395S probably damaging Het
Ccdc110 G A 8: 45,941,746 V225M probably benign Het
Ccdc30 A T 4: 119,353,176 S248T probably damaging Het
Cdh7 C A 1: 110,100,027 Q501K probably damaging Het
Cwc27 T C 13: 104,792,637 D266G probably benign Het
Cyp2d40 T A 15: 82,761,133 probably null Het
Cyp4a32 T G 4: 115,610,534 N238K probably benign Het
Dgcr8 C T 16: 18,280,291 G412E probably damaging Het
Disp2 C A 2: 118,791,583 A932D probably damaging Het
Dlg4 T A 11: 70,031,746 N291K possibly damaging Het
Dnajc7 A G 11: 100,601,730 I39T probably damaging Het
Eno3 T C 11: 70,661,470 V316A probably damaging Het
Ep400 G A 5: 110,726,902 T944I probably benign Het
Ezh2 T G 6: 47,552,490 probably null Het
F7 A T 8: 13,034,783 I270F possibly damaging Het
Fancc A G 13: 63,340,432 F245L probably benign Het
Fzd7 G A 1: 59,483,006 C16Y possibly damaging Het
Gm29394 A G 15: 58,028,612 *200Q probably null Het
Ikbkap G A 4: 56,786,666 Q426* probably null Het
Ints8 A G 4: 11,245,722 probably null Het
Krt36 A T 11: 100,102,302 I449N probably damaging Het
Ldlr A T 9: 21,737,913 H328L probably damaging Het
Limk2 T C 11: 3,353,455 N101S possibly damaging Het
Lrp4 A G 2: 91,476,305 N321S probably benign Het
Mafk T C 5: 139,800,145 S33P probably damaging Het
Mbtps1 T C 8: 119,518,219 Y831C probably damaging Het
Mfge8 T A 7: 79,134,765 I344F probably damaging Het
Myo5b T C 18: 74,733,990 V1430A probably benign Het
Nbas G A 12: 13,558,685 R2154H probably benign Het
Nlrp6 G A 7: 140,923,046 R355H probably damaging Het
Noc4l T C 5: 110,653,023 T76A probably benign Het
Nrp1 T A 8: 128,476,282 C583S probably damaging Het
Olfr1161 T A 2: 88,025,133 M137K probably damaging Het
Olfr1362 C T 13: 21,611,913 D19N probably benign Het
Pgm5 T A 19: 24,815,749 I318F probably damaging Het
Phf1 T A 17: 26,937,492 V536D probably damaging Het
Prpf4b C A 13: 34,892,150 A641D probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm47 A G 5: 66,024,991 I433T probably benign Het
S100a3 G A 3: 90,602,311 E88K probably benign Het
Sesn1 A G 10: 41,811,112 I31V probably benign Het
Son T A 16: 91,659,718 S1784R probably damaging Het
Srbd1 G T 17: 85,985,437 D901E probably damaging Het
St8sia6 C T 2: 13,672,605 D134N possibly damaging Het
Synpo2 T A 3: 123,114,398 D423V probably damaging Het
Vmn2r108 A G 17: 20,472,121 S158P probably damaging Het
Vmn2r109 A T 17: 20,540,740 V785E probably damaging Het
Zfp143 A G 7: 110,074,068 D124G probably benign Het
Zfp251 A G 15: 76,870,284 L54P probably damaging Het
Zfp324 G T 7: 12,970,643 S253I possibly damaging Het
Zfp59 A G 7: 27,854,134 E337G possibly damaging Het
Zfp663 G T 2: 165,353,517 Q261K probably benign Het
Zhx3 T C 2: 160,781,693 probably null Het
Other mutations in Ddx11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Ddx11 APN 17 66134137 missense probably damaging 1.00
IGL01577:Ddx11 APN 17 66139403 missense possibly damaging 0.95
IGL02558:Ddx11 APN 17 66148672 missense probably damaging 0.99
IGL02801:Ddx11 APN 17 66148033 missense probably benign 0.03
R1550:Ddx11 UTSW 17 66138220 missense probably benign 0.16
R1601:Ddx11 UTSW 17 66150385 missense probably damaging 1.00
R1625:Ddx11 UTSW 17 66150697 missense probably benign 0.45
R1714:Ddx11 UTSW 17 66148759 missense probably damaging 1.00
R1867:Ddx11 UTSW 17 66135939 intron probably null
R1959:Ddx11 UTSW 17 66130728 missense probably benign 0.27
R1980:Ddx11 UTSW 17 66148739 missense probably damaging 0.97
R2392:Ddx11 UTSW 17 66149973 missense probably damaging 1.00
R3118:Ddx11 UTSW 17 66149277 missense probably damaging 1.00
R3425:Ddx11 UTSW 17 66139439 missense possibly damaging 0.62
R3983:Ddx11 UTSW 17 66134130 missense probably damaging 1.00
R4571:Ddx11 UTSW 17 66130773 missense probably benign 0.20
R4576:Ddx11 UTSW 17 66150726 missense probably damaging 1.00
R4847:Ddx11 UTSW 17 66130801 missense probably damaging 1.00
R5010:Ddx11 UTSW 17 66147722 missense possibly damaging 0.60
R5414:Ddx11 UTSW 17 66148768 missense probably benign 0.40
R5610:Ddx11 UTSW 17 66150026 missense probably damaging 1.00
R5822:Ddx11 UTSW 17 66129981 missense probably benign 0.00
R5972:Ddx11 UTSW 17 66148090 missense probably benign 0.05
R6017:Ddx11 UTSW 17 66130017 missense probably benign 0.02
R6267:Ddx11 UTSW 17 66150729 critical splice donor site probably null
R6296:Ddx11 UTSW 17 66150729 critical splice donor site probably null
R7205:Ddx11 UTSW 17 66130771 missense probably benign 0.25
R7531:Ddx11 UTSW 17 66138219 missense probably benign 0.00
R7544:Ddx11 UTSW 17 66126285 missense probably damaging 0.98
R7593:Ddx11 UTSW 17 66126198 missense possibly damaging 0.48
R7778:Ddx11 UTSW 17 66130548 critical splice donor site probably null
R7824:Ddx11 UTSW 17 66130548 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTGCTGATGGCGTATTCCAAG -3'
(R):5'- AGCAAGTCACGGCTCCTACTTCTC -3'

Sequencing Primer
(F):5'- TCAGCTGGGAACAGTCGTAT -3'
(R):5'- TGGTCTACACAGCCAGATTGAC -3'
Posted On2014-04-24