Mutagenetix > Incidental Mutation

Incidental Mutation 'R1588:C4b'

177675

Institutional Source

Beutler Lab

Gene Symbol

C4b

Ensembl Gene

ENSMUSG00000073418

Gene Name

complement component 4B (Chido blood group)

Synonyms

C4, Ss

MMRRC Submission

039625-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1588 (G1)

Quality Score

174

Status

Not validated

Chromosome

Chromosomal Location

34728380-34743882 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34741025 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 326 (I326V)

Ref Sequence

ENSEMBL: ENSMUSP00000069418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069507]

AlphaFold

P01029

Predicted Effect

probably benign
Transcript: ENSMUST00000069507
AA Change: I326V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: I326V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:A2M_N	138	231	2e-19	PFAM
A2M_N_2	470	609	2.87e-26	SMART
ANATO	700	734	3.58e-12	SMART
low complexity region	761	771	N/A	INTRINSIC
A2M	779	867	1.46e-27	SMART
Pfam:Thiol-ester_cl	995	1024	7.7e-13	PFAM
Pfam:A2M_comp	1047	1313	1.3e-82	PFAM
low complexity region	1441	1447	N/A	INTRINSIC
A2M_recep	1475	1564	1.03e-36	SMART
C345C	1608	1720	5.69e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173057

SMART Domains

Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

Domain	Start	End	E-Value	Type
Pfam:A2M	1	62	6.5e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174597

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.0%
20x: 87.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc4	A	G	14: 118,534,072	V869A	probably benign	Het
Ablim1	C	T	19: 57,083,547	M1I	probably null	Het
Adamts13	A	T	2: 26,975,675	I81F	probably benign	Het
Akap11	A	T	14: 78,510,245	N1567K	possibly damaging	Het
Arrdc4	G	A	7: 68,741,736	T261M	possibly damaging	Het
Casp8ap2	G	A	4: 32,640,541	A532T	probably benign	Het
Ccdc129	A	G	6: 55,978,503	E1032G	possibly damaging	Het
Ccdc134	A	G	15: 82,135,136	T187A	probably benign	Het
Cdh8	T	C	8: 99,190,407	N359D	probably damaging	Het
Cep97	A	G	16: 55,927,821	L82P	probably damaging	Het
Cfap53	A	T	18: 74,307,373	R404S	probably benign	Het
Chrng	C	A	1: 87,207,507	F179L	probably damaging	Het
Ddi1	A	T	9: 6,265,391	I326K	probably damaging	Het
Decr2	T	C	17: 26,083,028	T243A	possibly damaging	Het
Dip2c	T	C	13: 9,665,864	V1502A	probably damaging	Het
Edem1	T	C	6: 108,841,679	V216A	probably damaging	Het
Fat2	A	C	11: 55,283,404	V2161G	probably damaging	Het
Fbn1	T	C	2: 125,319,114	T2169A	probably benign	Het
Fmn1	T	C	2: 113,365,698	V581A	unknown	Het
Gm13088	G	T	4: 143,655,551	L192M	probably damaging	Het
Hip1r	A	T	5: 123,996,575	D350V	probably damaging	Het
Ift140	G	A	17: 25,087,985	R898H	probably damaging	Het
Il12a	A	G	3: 68,695,563	I159V	probably benign	Het
Kl	A	G	5: 150,982,632	E489G	probably benign	Het
Klhl3	T	C	13: 58,013,898	E461G	probably damaging	Het
Masp1	T	C	16: 23,494,654	Y177C	probably damaging	Het
Nop58	T	A	1: 59,702,872	Y187N	probably damaging	Het
Npc1l1	A	G	11: 6,217,785	V1002A	probably benign	Het
Ntrk1	A	T	3: 87,780,077	Y683*	probably null	Het
Olfr1053	T	C	2: 86,314,530	Y252C	probably damaging	Het
Olfr1362	C	T	13: 21,611,913	D19N	probably benign	Het
Olfr71	C	T	4: 43,705,923	C215Y	probably damaging	Het
Olfr742	A	G	14: 50,516,127	I308V	probably benign	Het
Osbpl6	T	C	2: 76,579,216	V367A	probably benign	Het
Phip	A	G	9: 82,900,828	W855R	probably damaging	Het
Phlpp1	A	G	1: 106,380,385	S1131G	probably damaging	Het
Pkdrej	A	T	15: 85,817,241	V1498E	probably benign	Het
Prkaa2	T	C	4: 105,051,223	N152D	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Pxdn	G	A	12: 30,002,559	V732M	probably damaging	Het
Rccd1	C	T	7: 80,320,111	W223*	probably null	Het
Riox2	T	A	16: 59,475,583	S16T	possibly damaging	Het
Scn5a	C	T	9: 119,521,301	V836I	probably damaging	Het
Serpinf1	G	A	11: 75,410,250	R380C	probably damaging	Het
Sf3b1	A	T	1: 54,997,177	N912K	probably benign	Het
Shprh	T	A	10: 11,164,744	C134S	probably damaging	Het
Skint8	T	A	4: 111,928,727	C123*	probably null	Het
Slc16a13	G	T	11: 70,218,595	S360*	probably null	Het
Srr	A	G	11: 74,908,803	I282T	possibly damaging	Het
Trpm1	T	C	7: 64,223,817	F607L	possibly damaging	Het
Ttn	T	C	2: 76,709,526	D34372G	probably benign	Het
Tub	C	T	7: 109,029,681	T401I	probably damaging	Het
Wdhd1	T	C	14: 47,256,236	E9G	probably damaging	Het
Wdyhv1	T	A	15: 58,157,889		probably null	Het
Yipf3	T	A	17: 46,250,861	F198Y	possibly damaging	Het
Zfp955a	C	T	17: 33,241,817	R447K	probably benign	Het

Other mutations in C4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:C4b	APN	17	34734428	missense	probably damaging	1.00
IGL00433:C4b	APN	17	34742041	missense	possibly damaging	0.75
IGL00471:C4b	APN	17	34734429	missense	probably damaging	1.00
IGL00515:C4b	APN	17	34728891	missense	probably damaging	1.00
IGL01599:C4b	APN	17	34743019	splice site	probably benign
IGL01761:C4b	APN	17	34739938	missense	possibly damaging	0.56
IGL02004:C4b	APN	17	34739010	unclassified	probably benign
IGL02215:C4b	APN	17	34734491	missense	probably damaging	1.00
IGL02517:C4b	APN	17	34734408	missense	probably benign	0.01
IGL02926:C4b	APN	17	34730712	missense	possibly damaging	0.95
IGL03031:C4b	APN	17	34731130	missense	possibly damaging	0.47
IGL03057:C4b	APN	17	34737764	unclassified	probably benign
IGL03165:C4b	APN	17	34739955	missense	probably benign	0.13
IGL03380:C4b	APN	17	34740286	missense	probably benign	0.01
Aspiration	UTSW	17	34734442	missense	probably benign	0.00
Inspiration	UTSW	17	34732166	splice site	probably null
Peroration	UTSW	17	34729399	critical splice donor site	probably null
perspiration	UTSW	17	34729831	missense	probably damaging	1.00
FR4548:C4b	UTSW	17	34740997	missense	probably benign	0.00
PIT4142001:C4b	UTSW	17	34733701	missense	probably benign	0.01
R0064:C4b	UTSW	17	34738856	missense	probably damaging	1.00
R0113:C4b	UTSW	17	34741240	missense	probably damaging	0.98
R0143:C4b	UTSW	17	34734219	unclassified	probably benign
R0254:C4b	UTSW	17	34734776	missense	probably benign	0.00
R0320:C4b	UTSW	17	34733161	missense	probably benign	0.01
R0391:C4b	UTSW	17	34735614	splice site	probably benign
R0399:C4b	UTSW	17	34728869	missense	probably damaging	1.00
R0467:C4b	UTSW	17	34736127	missense	probably benign	0.01
R0549:C4b	UTSW	17	34735415	missense	probably damaging	1.00
R0561:C4b	UTSW	17	34734417	missense	probably damaging	0.99
R0662:C4b	UTSW	17	34730888	missense	probably damaging	1.00
R0941:C4b	UTSW	17	34740055	missense	probably benign
R1161:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1169:C4b	UTSW	17	34742972	missense	probably benign	0.14
R1186:C4b	UTSW	17	34736309	missense	possibly damaging	0.47
R1310:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1398:C4b	UTSW	17	34730719	unclassified	probably benign
R1472:C4b	UTSW	17	34743769	nonsense	probably null
R1496:C4b	UTSW	17	34740021	missense	probably benign	0.30
R1544:C4b	UTSW	17	34738967	missense	probably benign	0.13
R1645:C4b	UTSW	17	34740597	missense	probably damaging	1.00
R1664:C4b	UTSW	17	34732978	missense	probably damaging	1.00
R1678:C4b	UTSW	17	34743650	missense	probably benign	0.05
R1710:C4b	UTSW	17	34743664	splice site	probably benign
R1713:C4b	UTSW	17	34729271	splice site	probably benign
R1770:C4b	UTSW	17	34736927	missense	possibly damaging	0.78
R1859:C4b	UTSW	17	34735553	missense	probably benign
R1924:C4b	UTSW	17	34729657	missense	probably damaging	1.00
R2057:C4b	UTSW	17	34728620	missense	probably damaging	1.00
R2060:C4b	UTSW	17	34736101	missense	probably damaging	1.00
R2184:C4b	UTSW	17	34737702	missense	probably benign	0.27
R2306:C4b	UTSW	17	34728518	missense	probably benign	0.00
R2363:C4b	UTSW	17	34736058	splice site	probably benign
R2365:C4b	UTSW	17	34736058	splice site	probably benign
R2379:C4b	UTSW	17	34735743	missense	possibly damaging	0.81
R2860:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R2861:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R3551:C4b	UTSW	17	34741872	missense	possibly damaging	0.75
R3765:C4b	UTSW	17	34729840	missense	probably damaging	0.98
R4157:C4b	UTSW	17	34742855	missense	probably damaging	1.00
R4299:C4b	UTSW	17	34731144	missense	possibly damaging	0.52
R4365:C4b	UTSW	17	34734743	missense	possibly damaging	0.65
R4411:C4b	UTSW	17	34728864	missense	probably damaging	1.00
R4613:C4b	UTSW	17	34734551	missense	probably benign	0.12
R4784:C4b	UTSW	17	34733406	missense	probably benign	0.00
R4790:C4b	UTSW	17	34734143	missense	probably benign	0.01
R4831:C4b	UTSW	17	34736890	splice site	probably null
R4879:C4b	UTSW	17	34743647	missense	probably damaging	0.99
R5036:C4b	UTSW	17	34740445	critical splice acceptor site	probably null
R5361:C4b	UTSW	17	34741238	missense	probably benign	0.15
R5384:C4b	UTSW	17	34737661	missense	possibly damaging	0.89
R5518:C4b	UTSW	17	34734442	missense	probably benign	0.00
R5590:C4b	UTSW	17	34740335	missense	probably damaging	0.98
R5643:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5644:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5833:C4b	UTSW	17	34730673	missense	probably damaging	1.00
R5931:C4b	UTSW	17	34729193	missense	probably damaging	0.99
R6178:C4b	UTSW	17	34733406	missense	probably benign	0.00
R6209:C4b	UTSW	17	34741087	missense	possibly damaging	0.93
R6225:C4b	UTSW	17	34738874	missense	possibly damaging	0.64
R6518:C4b	UTSW	17	34734205	missense	probably damaging	0.98
R6613:C4b	UTSW	17	34733565	missense	probably damaging	0.99
R6781:C4b	UTSW	17	34742954	missense	probably damaging	0.99
R6807:C4b	UTSW	17	34730956	missense	probably benign	0.17
R6858:C4b	UTSW	17	34729831	missense	probably damaging	1.00
R6962:C4b	UTSW	17	34732166	splice site	probably null
R7068:C4b	UTSW	17	34733477	missense	probably damaging	1.00
R7081:C4b	UTSW	17	34735443	missense	probably benign	0.27
R7105:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R7211:C4b	UTSW	17	34735534	missense	possibly damaging	0.92
R7296:C4b	UTSW	17	34743659	missense	probably damaging	1.00
R7314:C4b	UTSW	17	34740356	missense	probably benign
R7330:C4b	UTSW	17	34730472	missense	probably damaging	1.00
R7397:C4b	UTSW	17	34742390	missense	possibly damaging	0.80
R7437:C4b	UTSW	17	34734733	missense	probably benign	0.10
R7490:C4b	UTSW	17	34731080	nonsense	probably null
R7597:C4b	UTSW	17	34739675	missense	probably benign
R7633:C4b	UTSW	17	34729399	critical splice donor site	probably null
R7900:C4b	UTSW	17	34739777	missense	probably benign	0.03
R7910:C4b	UTSW	17	34740352	missense	probably benign	0.00
R7923:C4b	UTSW	17	34742380	missense	probably damaging	1.00
R7960:C4b	UTSW	17	34741278	splice site	probably null
R8420:C4b	UTSW	17	34734539	missense	probably damaging	0.97
R8467:C4b	UTSW	17	34732813	missense	possibly damaging	0.51
R8558:C4b	UTSW	17	34736567	missense	probably damaging	1.00
R8725:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8727:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8853:C4b	UTSW	17	34729905	missense	possibly damaging	0.91
R8934:C4b	UTSW	17	34732984	missense	possibly damaging	0.78
R8944:C4b	UTSW	17	34742939	missense	probably benign	0.00
R8960:C4b	UTSW	17	34733918	missense	probably damaging	1.00
R8982:C4b	UTSW	17	34734364	critical splice donor site	probably null
R9104:C4b	UTSW	17	34729259	missense	probably benign	0.39
R9114:C4b	UTSW	17	34729430	missense	probably damaging	0.99
R9348:C4b	UTSW	17	34733185	missense	probably benign	0.01
R9428:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R9533:C4b	UTSW	17	34737724	nonsense	probably null
R9591:C4b	UTSW	17	34738955	missense	probably benign	0.00
Z1176:C4b	UTSW	17	34731147	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CGGCCTATCAGATGGTGAACCAAG -3'
(R):5'- TACATCTATGGGAAGCCCGTGCAG -3'

Sequencing Primer
(F):5'- GGCATCAGGAGCTGTACTG -3'
(R):5'- TGGCATACACACGGTTTGC -3'

Posted On

2014-04-24