Incidental Mutation 'R1589:Cntnap5a'
Institutional Source Beutler Lab
Gene Symbol Cntnap5a
Ensembl Gene ENSMUSG00000070695
Gene Namecontactin associated protein-like 5A
MMRRC Submission 039626-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1589 (G1)
Quality Score225
Status Validated
Chromosomal Location115684756-116587323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116060200 bp
Amino Acid Change Phenylalanine to Leucine at position 154 (F154L)
Ref Sequence ENSEMBL: ENSMUSP00000035732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043725]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043725
AA Change: F154L

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035732
Gene: ENSMUSG00000070695
AA Change: F154L

signal peptide 1 24 N/A INTRINSIC
FA58C 33 174 1.63e-13 SMART
LamG 201 338 1.4e-26 SMART
LamG 388 522 1.5e-26 SMART
EGF 550 584 2.16e-1 SMART
Blast:FBG 587 772 2e-81 BLAST
LamG 812 939 1.54e-28 SMART
EGF 960 996 2.28e0 SMART
LamG 1037 1173 4.73e-15 SMART
transmembrane domain 1241 1263 N/A INTRINSIC
Meta Mutation Damage Score 0.0834 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the neurexin family, members of which function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,441 probably benign Het
Aadacl2 C T 3: 60,010,576 T82I probably benign Het
Acadl T C 1: 66,853,223 N147S probably benign Het
Actr3 A T 1: 125,408,563 M79K probably damaging Het
Agbl3 A G 6: 34,857,517 S874G possibly damaging Het
Aoah A T 13: 21,002,948 T472S probably damaging Het
Asb16 A T 11: 102,268,995 D58V probably damaging Het
B4galt1 T C 4: 40,823,575 D172G probably benign Het
Bax T C 7: 45,465,247 N55S possibly damaging Het
Bdkrb2 A G 12: 105,591,859 N120D possibly damaging Het
Bicdl1 T C 5: 115,651,266 probably benign Het
Cand1 A G 10: 119,213,566 L425P probably damaging Het
Caskin1 G A 17: 24,505,478 probably null Het
Cd248 C T 19: 5,069,932 P603S probably benign Het
Cep95 G T 11: 106,800,104 R143L probably benign Het
Clptm1l G T 13: 73,614,673 probably null Het
Cyld A T 8: 88,709,990 I303F possibly damaging Het
Dock2 A G 11: 34,706,461 S370P probably damaging Het
Enah G T 1: 181,922,293 T327K probably damaging Het
Farp2 A T 1: 93,579,860 S427C probably damaging Het
Fbxw11 C T 11: 32,733,612 T301M probably damaging Het
Foxc2 A T 8: 121,117,176 T188S probably benign Het
Fzd2 A G 11: 102,606,328 T533A probably benign Het
Glb1l2 G T 9: 26,769,038 S248* probably null Het
Glul A T 1: 153,905,538 probably benign Het
Gm28042 A G 2: 120,041,406 T946A probably benign Het
Golga3 T A 5: 110,181,783 D2E probably damaging Het
Grm1 A T 10: 10,719,967 F639Y probably benign Het
Gzmn A G 14: 56,165,911 L247P probably benign Het
Hgf T G 5: 16,613,785 I525R probably damaging Het
Hnrnpul2 T A 19: 8,831,332 D719E probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itga9 T C 9: 118,607,117 probably null Het
Itgb1 T A 8: 128,705,458 C16S probably damaging Het
Itgb1 G T 8: 128,705,459 C16F possibly damaging Het
Kat14 A G 2: 144,394,100 I251V probably benign Het
Kdsr A T 1: 106,734,541 probably null Het
Kif12 T A 4: 63,166,500 E527V probably benign Het
Larp1b T C 3: 41,033,474 S44P probably damaging Het
Lonp2 T C 8: 86,673,072 probably benign Het
Lrp1 C T 10: 127,605,606 S216N probably benign Het
Lrrc19 T C 4: 94,640,950 S32G probably benign Het
Mdm2 G A 10: 117,690,529 T335M probably benign Het
Mettl25 A G 10: 105,779,632 Y504H probably damaging Het
Mill1 T C 7: 18,245,647 I13T probably benign Het
Mmachc T A 4: 116,703,524 Q258L probably benign Het
Mpdz T A 4: 81,421,176 I5L probably benign Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Mtmr11 A G 3: 96,168,113 T370A probably benign Het
Nmi T C 2: 51,958,977 I34V possibly damaging Het
Obscn A T 11: 59,036,075 M5538K possibly damaging Het
Ogdhl T C 14: 32,325,865 I24T probably benign Het
Olfr1477 C T 19: 13,502,757 T138M probably benign Het
Olfr675 A G 7: 105,024,560 V140A probably benign Het
Olfr703 A G 7: 106,845,196 Y195C possibly damaging Het
Olfr816 A G 10: 129,911,681 V199A probably benign Het
Omp G T 7: 98,145,359 D20E probably benign Het
Otog A G 7: 46,283,908 H1291R probably benign Het
Pgbd1 A G 13: 21,423,292 L244P probably damaging Het
Ranbp2 A G 10: 58,463,986 I481V probably benign Het
Rbp3 A T 14: 33,955,792 I566F probably damaging Het
Rsph4a A G 10: 33,905,529 D125G probably benign Het
Scn11a A G 9: 119,769,807 V1219A probably damaging Het
Serpine3 G A 14: 62,674,381 G264D probably benign Het
Slc4a10 T C 2: 62,257,462 F400L probably damaging Het
Slco1a4 C T 6: 141,845,447 V8I probably benign Het
Soga1 A T 2: 157,027,637 M1026K probably benign Het
Spen T C 4: 141,488,024 D499G unknown Het
Stk32c A G 7: 139,119,015 probably null Het
Tars A G 15: 11,388,175 V485A probably benign Het
Tcerg1l A G 7: 138,361,767 L258P probably damaging Het
Tmc2 A T 2: 130,247,960 I622F probably damaging Het
Tmem183a A T 1: 134,354,706 N220K probably damaging Het
Tnni3 T C 7: 4,520,526 D146G probably damaging Het
Trappc11 G T 8: 47,501,680 D908E probably damaging Het
Trappc8 A G 18: 20,863,551 Y436H probably damaging Het
Ttc41 G A 10: 86,776,390 V1176I probably benign Het
Ube2b A G 11: 51,997,872 V24A probably benign Het
Usp30 T C 5: 114,112,961 C233R probably damaging Het
Vmn1r87 T A 7: 13,131,776 T195S possibly damaging Het
Vmn2r24 T C 6: 123,806,520 probably benign Het
Vmn2r81 C A 10: 79,293,024 T583N probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr1 C A 5: 38,529,972 V239L probably benign Het
Wdr17 C T 8: 54,703,907 probably benign Het
Zfhx4 A C 3: 5,241,729 D5A probably damaging Het
Zfyve27 T C 19: 42,171,745 probably null Het
Other mutations in Cntnap5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Cntnap5a APN 1 116117677 missense possibly damaging 0.48
IGL00929:Cntnap5a APN 1 116060274 splice site probably null
IGL00959:Cntnap5a APN 1 116184327 missense probably benign 0.00
IGL01721:Cntnap5a APN 1 116157637 missense probably benign
IGL02009:Cntnap5a APN 1 116157494 missense probably benign 0.15
IGL02111:Cntnap5a APN 1 116089352 missense probably benign 0.00
IGL02198:Cntnap5a APN 1 116580532 missense probably benign
IGL02751:Cntnap5a APN 1 116184457 critical splice donor site probably null
IGL02752:Cntnap5a APN 1 116580531 missense probably benign 0.00
IGL02989:Cntnap5a APN 1 116412083 splice site probably benign
IGL03195:Cntnap5a APN 1 116157448 missense probably benign 0.00
PIT4142001:Cntnap5a UTSW 1 115684956 start gained probably benign
R0294:Cntnap5a UTSW 1 115915316 missense probably benign
R0377:Cntnap5a UTSW 1 116292529 missense probably benign 0.04
R0597:Cntnap5a UTSW 1 116184461 splice site probably benign
R0616:Cntnap5a UTSW 1 116580549 missense possibly damaging 0.80
R0725:Cntnap5a UTSW 1 116292476 missense probably benign 0.25
R0842:Cntnap5a UTSW 1 116442223 missense probably damaging 0.96
R1103:Cntnap5a UTSW 1 116580669 missense possibly damaging 0.81
R1265:Cntnap5a UTSW 1 116428518 missense possibly damaging 0.49
R1467:Cntnap5a UTSW 1 115685168 nonsense probably null
R1467:Cntnap5a UTSW 1 115685168 nonsense probably null
R1470:Cntnap5a UTSW 1 116259519 missense probably damaging 1.00
R1470:Cntnap5a UTSW 1 116259519 missense probably damaging 1.00
R1474:Cntnap5a UTSW 1 116442373 nonsense probably null
R1476:Cntnap5a UTSW 1 115901020 missense probably damaging 1.00
R1481:Cntnap5a UTSW 1 116117663 missense probably damaging 1.00
R1512:Cntnap5a UTSW 1 115900950 missense probably benign
R1526:Cntnap5a UTSW 1 116428477 missense probably benign
R1603:Cntnap5a UTSW 1 116412101 missense possibly damaging 0.80
R1728:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1728:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1728:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1729:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1729:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1729:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1730:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1730:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1730:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1739:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1739:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1739:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1762:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1762:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1762:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1783:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1783:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1783:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1785:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1785:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1785:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1816:Cntnap5a UTSW 1 116428888 missense probably benign 0.19
R1872:Cntnap5a UTSW 1 116089210 missense probably benign 0.02
R2095:Cntnap5a UTSW 1 116442260 missense probably damaging 1.00
R2113:Cntnap5a UTSW 1 116188365 missense probably damaging 0.98
R2144:Cntnap5a UTSW 1 116101710 missense probably benign 0.14
R2171:Cntnap5a UTSW 1 116188402 missense possibly damaging 0.95
R2219:Cntnap5a UTSW 1 116580639 missense possibly damaging 0.83
R2220:Cntnap5a UTSW 1 116580639 missense possibly damaging 0.83
R2571:Cntnap5a UTSW 1 116184362 missense probably damaging 1.00
R3019:Cntnap5a UTSW 1 116101569 missense probably benign
R3827:Cntnap5a UTSW 1 116117679 missense probably benign 0.14
R3870:Cntnap5a UTSW 1 116060249 missense probably damaging 1.00
R3871:Cntnap5a UTSW 1 116060249 missense probably damaging 1.00
R4041:Cntnap5a UTSW 1 116184399 missense probably benign 0.00
R4080:Cntnap5a UTSW 1 116101574 missense probably benign 0.01
R4260:Cntnap5a UTSW 1 116446595 missense probably benign 0.31
R4685:Cntnap5a UTSW 1 116446680 missense possibly damaging 0.69
R4781:Cntnap5a UTSW 1 116412201 missense possibly damaging 0.88
R4785:Cntnap5a UTSW 1 116101565 missense probably benign 0.00
R5057:Cntnap5a UTSW 1 115685213 missense probably benign 0.10
R5059:Cntnap5a UTSW 1 116428494 missense probably benign 0.44
R5101:Cntnap5a UTSW 1 116442296 missense probably benign 0.00
R5302:Cntnap5a UTSW 1 116157570 missense probably benign 0.15
R5451:Cntnap5a UTSW 1 115685143 missense probably benign
R5473:Cntnap5a UTSW 1 116089256 missense probably benign 0.12
R5886:Cntnap5a UTSW 1 116571672 critical splice donor site probably null
R6311:Cntnap5a UTSW 1 116412106 nonsense probably null
R6464:Cntnap5a UTSW 1 116184408 missense probably benign
R6497:Cntnap5a UTSW 1 116577897 missense probably damaging 1.00
R6781:Cntnap5a UTSW 1 116292397 missense probably benign 0.05
R7137:Cntnap5a UTSW 1 116089376 missense probably damaging 1.00
R7290:Cntnap5a UTSW 1 116221889 missense probably damaging 1.00
R7342:Cntnap5a UTSW 1 116060122 missense probably benign 0.00
R7367:Cntnap5a UTSW 1 116442295 missense probably benign 0.00
R7373:Cntnap5a UTSW 1 116580637 missense probably benign 0.20
R7426:Cntnap5a UTSW 1 116442380 missense probably benign 0.03
R7444:Cntnap5a UTSW 1 116292349 missense probably benign
R7582:Cntnap5a UTSW 1 116446632 missense probably damaging 1.00
R7745:Cntnap5a UTSW 1 116442283 missense probably benign
R7948:Cntnap5a UTSW 1 116580528 missense probably benign 0.01
R7995:Cntnap5a UTSW 1 116571547 missense probably damaging 0.99
R8041:Cntnap5a UTSW 1 116259479 missense probably damaging 0.99
Z1088:Cntnap5a UTSW 1 116060251 missense probably benign 0.08
Z1176:Cntnap5a UTSW 1 116428516 missense probably damaging 1.00
Z1177:Cntnap5a UTSW 1 116412168 missense probably benign 0.03
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- GGGCCtttgttttgttttatcttg -3'
(R):5'- attctattcccaaagcccaaatc -3'
Posted On2014-04-24