Mutagenetix > Incidental Mutation

Incidental Mutation 'R1589:Soga1'

177695

Institutional Source

Beutler Lab

Gene Symbol

Soga1

Ensembl Gene

ENSMUSG00000055485

Gene Name

suppressor of glucose, autophagy associated 1

Synonyms

D430036N24Rik, 9830001H06Rik

MMRRC Submission

039626-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.447) question?

Stock #

R1589 (G1)

Quality Score

194

Status

Validated

Chromosome

Chromosomal Location

157015799-157079254 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 157027637 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1026 (M1026K)

Ref Sequence

ENSEMBL: ENSMUSP00000066556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069098]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000069098
AA Change: M1026K

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000066556
Gene: ENSMUSG00000055485
AA Change: M1026K

Domain	Start	End	E-Value	Type
low complexity region	15	23	N/A	INTRINSIC
low complexity region	51	66	N/A	INTRINSIC
low complexity region	97	112	N/A	INTRINSIC
low complexity region	132	148	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
Blast:BRLZ	212	246	4e-8	BLAST
SCOP:d1fxkc_	216	350	1e-3	SMART
Pfam:DUF3166	378	472	2.3e-31	PFAM
Pfam:DUF3166	504	593	5.3e-31	PFAM
low complexity region	637	649	N/A	INTRINSIC
coiled coil region	807	867	N/A	INTRINSIC
low complexity region	872	884	N/A	INTRINSIC
low complexity region	938	950	N/A	INTRINSIC
Pfam:DUF4482	1065	1205	3.9e-28	PFAM
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1363	1377	N/A	INTRINSIC
low complexity region	1389	1418	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153229

Meta Mutation Damage Score

0.1231

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.8%
20x: 90.8%

Validation Efficiency

97% (89/92)

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700008P02Rik	A	G	3: 6,620,441		probably benign	Het
Aadacl2	C	T	3: 60,010,576	T82I	probably benign	Het
Acadl	T	C	1: 66,853,223	N147S	probably benign	Het
Actr3	A	T	1: 125,408,563	M79K	probably damaging	Het
Agbl3	A	G	6: 34,857,517	S874G	possibly damaging	Het
Aoah	A	T	13: 21,002,948	T472S	probably damaging	Het
Asb16	A	T	11: 102,268,995	D58V	probably damaging	Het
B4galt1	T	C	4: 40,823,575	D172G	probably benign	Het
Bax	T	C	7: 45,465,247	N55S	possibly damaging	Het
Bdkrb2	A	G	12: 105,591,859	N120D	possibly damaging	Het
Bicdl1	T	C	5: 115,651,266		probably benign	Het
Cand1	A	G	10: 119,213,566	L425P	probably damaging	Het
Caskin1	G	A	17: 24,505,478		probably null	Het
Cd248	C	T	19: 5,069,932	P603S	probably benign	Het
Cep95	G	T	11: 106,800,104	R143L	probably benign	Het
Clptm1l	G	T	13: 73,614,673		probably null	Het
Cntnap5a	T	C	1: 116,060,200	F154L	possibly damaging	Het
Cyld	A	T	8: 88,709,990	I303F	possibly damaging	Het
Dock2	A	G	11: 34,706,461	S370P	probably damaging	Het
Enah	G	T	1: 181,922,293	T327K	probably damaging	Het
Farp2	A	T	1: 93,579,860	S427C	probably damaging	Het
Fbxw11	C	T	11: 32,733,612	T301M	probably damaging	Het
Foxc2	A	T	8: 121,117,176	T188S	probably benign	Het
Fzd2	A	G	11: 102,606,328	T533A	probably benign	Het
Glb1l2	G	T	9: 26,769,038	S248*	probably null	Het
Glul	A	T	1: 153,905,538		probably benign	Het
Gm28042	A	G	2: 120,041,406	T946A	probably benign	Het
Golga3	T	A	5: 110,181,783	D2E	probably damaging	Het
Grm1	A	T	10: 10,719,967	F639Y	probably benign	Het
Gzmn	A	G	14: 56,165,911	L247P	probably benign	Het
Hgf	T	G	5: 16,613,785	I525R	probably damaging	Het
Hnrnpul2	T	A	19: 8,831,332	D719E	probably benign	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Itga9	T	C	9: 118,607,117		probably null	Het
Itgb1	T	A	8: 128,705,458	C16S	probably damaging	Het
Itgb1	G	T	8: 128,705,459	C16F	possibly damaging	Het
Kat14	A	G	2: 144,394,100	I251V	probably benign	Het
Kdsr	A	T	1: 106,734,541		probably null	Het
Kif12	T	A	4: 63,166,500	E527V	probably benign	Het
Larp1b	T	C	3: 41,033,474	S44P	probably damaging	Het
Lonp2	T	C	8: 86,673,072		probably benign	Het
Lrp1	C	T	10: 127,605,606	S216N	probably benign	Het
Lrrc19	T	C	4: 94,640,950	S32G	probably benign	Het
Mdm2	G	A	10: 117,690,529	T335M	probably benign	Het
Mettl25	A	G	10: 105,779,632	Y504H	probably damaging	Het
Mill1	T	C	7: 18,245,647	I13T	probably benign	Het
Mmachc	T	A	4: 116,703,524	Q258L	probably benign	Het
Mpdz	T	A	4: 81,421,176	I5L	probably benign	Het
Mrps2	C	T	2: 28,469,488	A119V	probably benign	Het
Mtmr11	A	G	3: 96,168,113	T370A	probably benign	Het
Nmi	T	C	2: 51,958,977	I34V	possibly damaging	Het
Obscn	A	T	11: 59,036,075	M5538K	possibly damaging	Het
Ogdhl	T	C	14: 32,325,865	I24T	probably benign	Het
Olfr1477	C	T	19: 13,502,757	T138M	probably benign	Het
Olfr675	A	G	7: 105,024,560	V140A	probably benign	Het
Olfr703	A	G	7: 106,845,196	Y195C	possibly damaging	Het
Olfr816	A	G	10: 129,911,681	V199A	probably benign	Het
Omp	G	T	7: 98,145,359	D20E	probably benign	Het
Otog	A	G	7: 46,283,908	H1291R	probably benign	Het
Pgbd1	A	G	13: 21,423,292	L244P	probably damaging	Het
Ranbp2	A	G	10: 58,463,986	I481V	probably benign	Het
Rbp3	A	T	14: 33,955,792	I566F	probably damaging	Het
Rsph4a	A	G	10: 33,905,529	D125G	probably benign	Het
Scn11a	A	G	9: 119,769,807	V1219A	probably damaging	Het
Serpine3	G	A	14: 62,674,381	G264D	probably benign	Het
Slc4a10	T	C	2: 62,257,462	F400L	probably damaging	Het
Slco1a4	C	T	6: 141,845,447	V8I	probably benign	Het
Spen	T	C	4: 141,488,024	D499G	unknown	Het
Stk32c	A	G	7: 139,119,015		probably null	Het
Tars	A	G	15: 11,388,175	V485A	probably benign	Het
Tcerg1l	A	G	7: 138,361,767	L258P	probably damaging	Het
Tmc2	A	T	2: 130,247,960	I622F	probably damaging	Het
Tmem183a	A	T	1: 134,354,706	N220K	probably damaging	Het
Tnni3	T	C	7: 4,520,526	D146G	probably damaging	Het
Trappc11	G	T	8: 47,501,680	D908E	probably damaging	Het
Trappc8	A	G	18: 20,863,551	Y436H	probably damaging	Het
Ttc41	G	A	10: 86,776,390	V1176I	probably benign	Het
Ube2b	A	G	11: 51,997,872	V24A	probably benign	Het
Usp30	T	C	5: 114,112,961	C233R	probably damaging	Het
Vmn1r87	T	A	7: 13,131,776	T195S	possibly damaging	Het
Vmn2r24	T	C	6: 123,806,520		probably benign	Het
Vmn2r81	C	A	10: 79,293,024	T583N	probably damaging	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Wdr1	C	A	5: 38,529,972	V239L	probably benign	Het
Wdr17	C	T	8: 54,703,907		probably benign	Het
Zfhx4	A	C	3: 5,241,729	D5A	probably damaging	Het
Zfyve27	T	C	19: 42,171,745		probably null	Het

Other mutations in Soga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Soga1	APN	2	157030864	missense	probably damaging	1.00
IGL00924:Soga1	APN	2	157040705	missense	probably damaging	0.99
IGL01723:Soga1	APN	2	157030614	missense	probably benign	0.00
IGL01749:Soga1	APN	2	157021541	splice site	probably benign
IGL02199:Soga1	APN	2	157030945	missense	probably damaging	1.00
IGL02262:Soga1	APN	2	157030906	missense	probably damaging	1.00
IGL02618:Soga1	APN	2	157040566	missense	probably damaging	1.00
IGL02643:Soga1	APN	2	157040743	missense	probably damaging	1.00
deglutition	UTSW	2	157039864	missense	possibly damaging	0.63
gulp	UTSW	2	157023817	nonsense	probably null
IGL02835:Soga1	UTSW	2	157041934	missense	possibly damaging	0.91
R0528:Soga1	UTSW	2	157020692	missense	probably damaging	1.00
R0535:Soga1	UTSW	2	157033289	missense	possibly damaging	0.89
R0726:Soga1	UTSW	2	157060262	missense	probably damaging	1.00
R1473:Soga1	UTSW	2	157020448	nonsense	probably null
R1615:Soga1	UTSW	2	157020743	missense	probably damaging	1.00
R1681:Soga1	UTSW	2	157030530	missense	possibly damaging	0.70
R1701:Soga1	UTSW	2	157030619	missense	probably damaging	1.00
R1872:Soga1	UTSW	2	157040261	missense	possibly damaging	0.88
R2056:Soga1	UTSW	2	157022827	missense	probably benign	0.00
R2118:Soga1	UTSW	2	157033325	missense	probably damaging	1.00
R2120:Soga1	UTSW	2	157033325	missense	probably damaging	1.00
R2121:Soga1	UTSW	2	157033325	missense	probably damaging	1.00
R2124:Soga1	UTSW	2	157033325	missense	probably damaging	1.00
R2249:Soga1	UTSW	2	157040093	missense	probably benign	0.08
R3147:Soga1	UTSW	2	157020364	missense	possibly damaging	0.91
R3758:Soga1	UTSW	2	157020638	missense	possibly damaging	0.77
R4601:Soga1	UTSW	2	157039924	missense	probably benign	0.41
R4646:Soga1	UTSW	2	157020506	missense	probably damaging	1.00
R4653:Soga1	UTSW	2	157040591	missense	probably damaging	1.00
R4736:Soga1	UTSW	2	157020554	missense	probably damaging	1.00
R4773:Soga1	UTSW	2	157030569	missense	probably benign	0.08
R4796:Soga1	UTSW	2	157020252	missense	probably benign
R4999:Soga1	UTSW	2	157022856	missense	probably benign	0.10
R5304:Soga1	UTSW	2	157023817	nonsense	probably null
R5369:Soga1	UTSW	2	157040734	missense	probably damaging	1.00
R5530:Soga1	UTSW	2	157020342	missense	probably damaging	1.00
R5712:Soga1	UTSW	2	157030921	missense	probably damaging	1.00
R5780:Soga1	UTSW	2	157018490	missense	probably damaging	0.98
R6162:Soga1	UTSW	2	157039864	missense	possibly damaging	0.63
R6253:Soga1	UTSW	2	157021419	missense	probably benign	0.00
R6303:Soga1	UTSW	2	157040764	missense	possibly damaging	0.91
R6304:Soga1	UTSW	2	157040764	missense	possibly damaging	0.91
R6523:Soga1	UTSW	2	157060343	nonsense	probably null
R7216:Soga1	UTSW	2	157018370	missense	possibly damaging	0.76
R7335:Soga1	UTSW	2	157031005	missense	possibly damaging	0.86
R7562:Soga1	UTSW	2	157053589	missense	probably damaging	1.00
R7593:Soga1	UTSW	2	157040856	missense	probably benign	0.40
R7788:Soga1	UTSW	2	157027584	missense	probably benign	0.09
R8013:Soga1	UTSW	2	157030786	critical splice donor site	probably null
R8263:Soga1	UTSW	2	157027590	missense	possibly damaging	0.94
R8299:Soga1	UTSW	2	157020731	missense	possibly damaging	0.93
R8814:Soga1	UTSW	2	157030531	nonsense	probably null
R9222:Soga1	UTSW	2	157039999	missense	probably benign	0.08
R9563:Soga1	UTSW	2	157060262	missense	probably damaging	1.00
R9607:Soga1	UTSW	2	157027568	missense	probably damaging	0.96
R9645:Soga1	UTSW	2	157027470	missense	probably damaging	1.00
R9690:Soga1	UTSW	2	157020214	missense	probably benign	0.06
R9727:Soga1	UTSW	2	157020248	missense	possibly damaging	0.89
X0019:Soga1	UTSW	2	157020264	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GATCGACACCTGCTCAGTGAGAAC -3'
(R):5'- ATGCTTATCTAGCCCCTTGGAGCC -3'

Sequencing Primer
(F):5'- CTGCTCAGTGAGAACTCGTG -3'
(R):5'- CTTGGAGCCACGGTGAG -3'

Posted On

2014-04-24