Incidental Mutation 'R1589:Mpdz'
ID 177705
Institutional Source Beutler Lab
Gene Symbol Mpdz
Ensembl Gene ENSMUSG00000028402
Gene Name multiple PDZ domain protein
Synonyms B930003D11Rik, MUPP1
MMRRC Submission 039626-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1589 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 81278500-81442815 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 81421176 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 5 (I5L)
Ref Sequence ENSEMBL: ENSMUSP00000102883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102830] [ENSMUST00000107258] [ENSMUST00000107262] [ENSMUST00000220807]
AlphaFold Q8VBX6
Predicted Effect probably benign
Transcript: ENSMUST00000102830
AA Change: I5L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099894
Gene: ENSMUSG00000028402
AA Change: I5L

L27 6 66 9.04e-3 SMART
PDZ 147 225 3.03e-23 SMART
PDZ 266 338 8.92e-21 SMART
low complexity region 345 360 N/A INTRINSIC
PDZ 386 464 6.07e-23 SMART
PDZ 556 627 7.31e-17 SMART
PDZ 701 780 9.94e-19 SMART
PDZ 1004 1080 3.44e-13 SMART
low complexity region 1111 1126 N/A INTRINSIC
PDZ 1148 1231 2.43e-22 SMART
low complexity region 1233 1251 N/A INTRINSIC
PDZ 1346 1421 3.41e-17 SMART
low complexity region 1434 1445 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
PDZ 1479 1552 2.69e-15 SMART
PDZ 1622 1697 3.2e-22 SMART
PDZ 1719 1792 3.62e-21 SMART
low complexity region 1798 1815 N/A INTRINSIC
PDZ 1856 1933 9.79e-18 SMART
PDZ 1980 2055 2.39e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107258
AA Change: I5L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102879
Gene: ENSMUSG00000028402
AA Change: I5L

PDZ 1 73 3.42e-8 SMART
low complexity region 104 119 N/A INTRINSIC
PDZ 141 224 2.43e-22 SMART
PDZ 306 381 3.41e-17 SMART
low complexity region 394 405 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
PDZ 439 512 2.69e-15 SMART
PDZ 582 657 3.2e-22 SMART
PDZ 679 752 3.62e-21 SMART
low complexity region 758 775 N/A INTRINSIC
PDZ 816 893 9.79e-18 SMART
PDZ 940 1015 2.39e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107262
AA Change: I5L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102883
Gene: ENSMUSG00000028402
AA Change: I5L

L27 6 66 9.04e-3 SMART
PDZ 147 225 3.03e-23 SMART
PDZ 266 338 8.92e-21 SMART
low complexity region 345 360 N/A INTRINSIC
PDZ 386 464 6.07e-23 SMART
PDZ 556 627 7.31e-17 SMART
PDZ 701 780 9.94e-19 SMART
PDZ 1004 1080 3.44e-13 SMART
low complexity region 1112 1127 N/A INTRINSIC
PDZ 1149 1232 2.43e-22 SMART
low complexity region 1234 1252 N/A INTRINSIC
PDZ 1347 1422 3.41e-17 SMART
low complexity region 1435 1446 N/A INTRINSIC
low complexity region 1455 1469 N/A INTRINSIC
PDZ 1480 1553 2.69e-15 SMART
PDZ 1623 1698 3.2e-22 SMART
PDZ 1720 1793 3.62e-21 SMART
low complexity region 1799 1816 N/A INTRINSIC
PDZ 1857 1934 9.79e-18 SMART
PDZ 1981 2056 2.39e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142273
Predicted Effect probably benign
Transcript: ENSMUST00000220807
AA Change: I5L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has multiple PDZ domains, which are hallmarks of protein-protein interactions. The encoded protein is known to interact with the HTR2C receptor and may cause it to clump at the cell surface. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mutant heterozygous mice are more sensitive to ethanol withdrawal effects and consume less alcohol than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,441 probably benign Het
Aadacl2 C T 3: 60,010,576 T82I probably benign Het
Acadl T C 1: 66,853,223 N147S probably benign Het
Actr3 A T 1: 125,408,563 M79K probably damaging Het
Agbl3 A G 6: 34,857,517 S874G possibly damaging Het
Aoah A T 13: 21,002,948 T472S probably damaging Het
Asb16 A T 11: 102,268,995 D58V probably damaging Het
B4galt1 T C 4: 40,823,575 D172G probably benign Het
Bax T C 7: 45,465,247 N55S possibly damaging Het
Bdkrb2 A G 12: 105,591,859 N120D possibly damaging Het
Bicdl1 T C 5: 115,651,266 probably benign Het
Cand1 A G 10: 119,213,566 L425P probably damaging Het
Caskin1 G A 17: 24,505,478 probably null Het
Cd248 C T 19: 5,069,932 P603S probably benign Het
Cep95 G T 11: 106,800,104 R143L probably benign Het
Clptm1l G T 13: 73,614,673 probably null Het
Cntnap5a T C 1: 116,060,200 F154L possibly damaging Het
Cyld A T 8: 88,709,990 I303F possibly damaging Het
Dock2 A G 11: 34,706,461 S370P probably damaging Het
Enah G T 1: 181,922,293 T327K probably damaging Het
Farp2 A T 1: 93,579,860 S427C probably damaging Het
Fbxw11 C T 11: 32,733,612 T301M probably damaging Het
Foxc2 A T 8: 121,117,176 T188S probably benign Het
Fzd2 A G 11: 102,606,328 T533A probably benign Het
Glb1l2 G T 9: 26,769,038 S248* probably null Het
Glul A T 1: 153,905,538 probably benign Het
Gm28042 A G 2: 120,041,406 T946A probably benign Het
Golga3 T A 5: 110,181,783 D2E probably damaging Het
Grm1 A T 10: 10,719,967 F639Y probably benign Het
Gzmn A G 14: 56,165,911 L247P probably benign Het
Hgf T G 5: 16,613,785 I525R probably damaging Het
Hnrnpul2 T A 19: 8,831,332 D719E probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itga9 T C 9: 118,607,117 probably null Het
Itgb1 T A 8: 128,705,458 C16S probably damaging Het
Itgb1 G T 8: 128,705,459 C16F possibly damaging Het
Kat14 A G 2: 144,394,100 I251V probably benign Het
Kdsr A T 1: 106,734,541 probably null Het
Kif12 T A 4: 63,166,500 E527V probably benign Het
Larp1b T C 3: 41,033,474 S44P probably damaging Het
Lonp2 T C 8: 86,673,072 probably benign Het
Lrp1 C T 10: 127,605,606 S216N probably benign Het
Lrrc19 T C 4: 94,640,950 S32G probably benign Het
Mdm2 G A 10: 117,690,529 T335M probably benign Het
Mettl25 A G 10: 105,779,632 Y504H probably damaging Het
Mill1 T C 7: 18,245,647 I13T probably benign Het
Mmachc T A 4: 116,703,524 Q258L probably benign Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Mtmr11 A G 3: 96,168,113 T370A probably benign Het
Nmi T C 2: 51,958,977 I34V possibly damaging Het
Obscn A T 11: 59,036,075 M5538K possibly damaging Het
Ogdhl T C 14: 32,325,865 I24T probably benign Het
Olfr1477 C T 19: 13,502,757 T138M probably benign Het
Olfr675 A G 7: 105,024,560 V140A probably benign Het
Olfr703 A G 7: 106,845,196 Y195C possibly damaging Het
Olfr816 A G 10: 129,911,681 V199A probably benign Het
Omp G T 7: 98,145,359 D20E probably benign Het
Otog A G 7: 46,283,908 H1291R probably benign Het
Pgbd1 A G 13: 21,423,292 L244P probably damaging Het
Ranbp2 A G 10: 58,463,986 I481V probably benign Het
Rbp3 A T 14: 33,955,792 I566F probably damaging Het
Rsph4a A G 10: 33,905,529 D125G probably benign Het
Scn11a A G 9: 119,769,807 V1219A probably damaging Het
Serpine3 G A 14: 62,674,381 G264D probably benign Het
Slc4a10 T C 2: 62,257,462 F400L probably damaging Het
Slco1a4 C T 6: 141,845,447 V8I probably benign Het
Soga1 A T 2: 157,027,637 M1026K probably benign Het
Spen T C 4: 141,488,024 D499G unknown Het
Stk32c A G 7: 139,119,015 probably null Het
Tars A G 15: 11,388,175 V485A probably benign Het
Tcerg1l A G 7: 138,361,767 L258P probably damaging Het
Tmc2 A T 2: 130,247,960 I622F probably damaging Het
Tmem183a A T 1: 134,354,706 N220K probably damaging Het
Tnni3 T C 7: 4,520,526 D146G probably damaging Het
Trappc11 G T 8: 47,501,680 D908E probably damaging Het
Trappc8 A G 18: 20,863,551 Y436H probably damaging Het
Ttc41 G A 10: 86,776,390 V1176I probably benign Het
Ube2b A G 11: 51,997,872 V24A probably benign Het
Usp30 T C 5: 114,112,961 C233R probably damaging Het
Vmn1r87 T A 7: 13,131,776 T195S possibly damaging Het
Vmn2r24 T C 6: 123,806,520 probably benign Het
Vmn2r81 C A 10: 79,293,024 T583N probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr1 C A 5: 38,529,972 V239L probably benign Het
Wdr17 C T 8: 54,703,907 probably benign Het
Zfhx4 A C 3: 5,241,729 D5A probably damaging Het
Zfyve27 T C 19: 42,171,745 probably null Het
Other mutations in Mpdz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Mpdz APN 4 81310224 nonsense probably null
IGL00325:Mpdz APN 4 81317631 missense probably damaging 1.00
IGL00497:Mpdz APN 4 81335742 missense probably benign 0.30
IGL00502:Mpdz APN 4 81369723 missense probably damaging 1.00
IGL00539:Mpdz APN 4 81361351 missense possibly damaging 0.83
IGL00938:Mpdz APN 4 81292512 missense probably damaging 1.00
IGL00990:Mpdz APN 4 81303584 splice site probably benign
IGL01394:Mpdz APN 4 81292491 missense possibly damaging 0.92
IGL01537:Mpdz APN 4 81369658 missense probably damaging 0.98
IGL01558:Mpdz APN 4 81295530 nonsense probably null
IGL01561:Mpdz APN 4 81284614 missense probably damaging 1.00
IGL01649:Mpdz APN 4 81303633 missense probably damaging 0.98
IGL01743:Mpdz APN 4 81317682 missense probably damaging 1.00
IGL01941:Mpdz APN 4 81286387 missense possibly damaging 0.91
IGL01969:Mpdz APN 4 81358724 missense probably damaging 0.98
IGL02023:Mpdz APN 4 81329529 missense probably damaging 0.99
IGL02081:Mpdz APN 4 81335869 missense probably damaging 1.00
IGL02304:Mpdz APN 4 81310157 missense possibly damaging 0.78
IGL02304:Mpdz APN 4 81297559 splice site probably benign
IGL02410:Mpdz APN 4 81297493 missense probably benign 0.13
IGL02449:Mpdz APN 4 81329422 splice site probably null
IGL02671:Mpdz APN 4 81290273 missense probably damaging 1.00
IGL02708:Mpdz APN 4 81284571 splice site probably null
IGL02718:Mpdz APN 4 81385202 missense probably damaging 1.00
IGL03065:Mpdz APN 4 81292565 missense probably damaging 0.98
IGL03378:Mpdz APN 4 81419048 splice site probably benign
PIT4458001:Mpdz UTSW 4 81419026 missense probably damaging 1.00
R0108:Mpdz UTSW 4 81381805 missense probably damaging 1.00
R0108:Mpdz UTSW 4 81381805 missense probably damaging 1.00
R0119:Mpdz UTSW 4 81292531 missense probably benign 0.44
R0402:Mpdz UTSW 4 81361440 missense possibly damaging 0.51
R0499:Mpdz UTSW 4 81292531 missense probably benign 0.44
R0718:Mpdz UTSW 4 81292473 missense possibly damaging 0.79
R0844:Mpdz UTSW 4 81421194 start gained probably benign
R0883:Mpdz UTSW 4 81359991 splice site probably benign
R0885:Mpdz UTSW 4 81369592 missense probably benign 0.04
R1344:Mpdz UTSW 4 81308319 missense probably benign 0.01
R1432:Mpdz UTSW 4 81292551 missense probably damaging 1.00
R1488:Mpdz UTSW 4 81348708 nonsense probably null
R1756:Mpdz UTSW 4 81306877 missense possibly damaging 0.87
R1940:Mpdz UTSW 4 81361443 missense probably benign 0.01
R2068:Mpdz UTSW 4 81335830 missense probably null 1.00
R2182:Mpdz UTSW 4 81348722 missense probably damaging 1.00
R2213:Mpdz UTSW 4 81310172 missense probably damaging 0.99
R2265:Mpdz UTSW 4 81383391 missense probably damaging 1.00
R2268:Mpdz UTSW 4 81383391 missense probably damaging 1.00
R2269:Mpdz UTSW 4 81383391 missense probably damaging 1.00
R3082:Mpdz UTSW 4 81285458 splice site probably benign
R3746:Mpdz UTSW 4 81363147 missense probably damaging 1.00
R3902:Mpdz UTSW 4 81307116 missense probably damaging 1.00
R4095:Mpdz UTSW 4 81383823 missense possibly damaging 0.77
R4097:Mpdz UTSW 4 81335700 missense probably damaging 1.00
R4206:Mpdz UTSW 4 81381762 missense probably benign 0.13
R4675:Mpdz UTSW 4 81383812 missense probably damaging 0.98
R4884:Mpdz UTSW 4 81361476 missense probably damaging 0.97
R5044:Mpdz UTSW 4 81381697 missense probably benign 0.16
R5050:Mpdz UTSW 4 81295448 missense probably benign 0.00
R5243:Mpdz UTSW 4 81306879 missense probably damaging 1.00
R5332:Mpdz UTSW 4 81292580 missense probably damaging 1.00
R5435:Mpdz UTSW 4 81283487 intron probably benign
R5720:Mpdz UTSW 4 81287694 missense probably damaging 0.99
R5743:Mpdz UTSW 4 81421188 start codon destroyed probably null 0.30
R5764:Mpdz UTSW 4 81356446 missense probably benign 0.13
R5876:Mpdz UTSW 4 81285474 nonsense probably null
R5938:Mpdz UTSW 4 81284614 missense probably damaging 1.00
R5988:Mpdz UTSW 4 81284575 critical splice donor site probably null
R6125:Mpdz UTSW 4 81297527 missense probably benign 0.00
R6178:Mpdz UTSW 4 81308365 missense probably damaging 1.00
R6235:Mpdz UTSW 4 81385281 missense probably damaging 1.00
R6293:Mpdz UTSW 4 81360056 missense probably damaging 1.00
R6387:Mpdz UTSW 4 81381709 missense possibly damaging 0.69
R6488:Mpdz UTSW 4 81287733 missense probably benign 0.11
R6536:Mpdz UTSW 4 81383417 missense probably damaging 1.00
R6673:Mpdz UTSW 4 81356430 missense probably benign 0.11
R6879:Mpdz UTSW 4 81348656 missense possibly damaging 0.81
R7180:Mpdz UTSW 4 81335751 missense probably damaging 0.98
R7199:Mpdz UTSW 4 81297333 missense probably damaging 0.98
R7209:Mpdz UTSW 4 81306877 missense possibly damaging 0.87
R7309:Mpdz UTSW 4 81381958 splice site probably null
R7359:Mpdz UTSW 4 81356395 missense probably benign 0.01
R7561:Mpdz UTSW 4 81307151 missense probably damaging 0.99
R7565:Mpdz UTSW 4 81303654 missense probably benign 0.01
R7738:Mpdz UTSW 4 81335749 missense probably benign 0.01
R7941:Mpdz UTSW 4 81282750 missense probably benign 0.04
R8074:Mpdz UTSW 4 81349087 missense probably benign 0.00
R8957:Mpdz UTSW 4 81332979 nonsense probably null
R8998:Mpdz UTSW 4 81284645 nonsense probably null
R8999:Mpdz UTSW 4 81284645 nonsense probably null
R9001:Mpdz UTSW 4 81381762 missense probably benign
R9223:Mpdz UTSW 4 81284630 missense probably damaging 1.00
R9415:Mpdz UTSW 4 81317668 nonsense probably null
RF013:Mpdz UTSW 4 81293592 missense possibly damaging 0.60
X0011:Mpdz UTSW 4 81292759 critical splice donor site probably null
Z1177:Mpdz UTSW 4 81320490 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gctgggatttgaactctggac -3'
Posted On 2014-04-24