Mutagenetix > Incidental Mutation

Incidental Mutation 'R1589:Mpdz'

177705

Institutional Source

Beutler Lab

Gene Symbol

Mpdz

Ensembl Gene

ENSMUSG00000028402

Gene Name

multiple PDZ domain protein

Synonyms

B930003D11Rik, MUPP1

MMRRC Submission

039626-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1589 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81278500-81442815 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 81421176 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 5 (I5L)

Ref Sequence

ENSEMBL: ENSMUSP00000102883 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102830] [ENSMUST00000107258] [ENSMUST00000107262] [ENSMUST00000220807]

AlphaFold

Q8VBX6

Predicted Effect

probably benign
Transcript: ENSMUST00000102830
AA Change: I5L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000099894
Gene: ENSMUSG00000028402
AA Change: I5L

Domain	Start	End	E-Value	Type
L27	6	66	9.04e-3	SMART
PDZ	147	225	3.03e-23	SMART
PDZ	266	338	8.92e-21	SMART
low complexity region	345	360	N/A	INTRINSIC
PDZ	386	464	6.07e-23	SMART
PDZ	556	627	7.31e-17	SMART
PDZ	701	780	9.94e-19	SMART
PDZ	1004	1080	3.44e-13	SMART
low complexity region	1111	1126	N/A	INTRINSIC
PDZ	1148	1231	2.43e-22	SMART
low complexity region	1233	1251	N/A	INTRINSIC
PDZ	1346	1421	3.41e-17	SMART
low complexity region	1434	1445	N/A	INTRINSIC
low complexity region	1454	1468	N/A	INTRINSIC
PDZ	1479	1552	2.69e-15	SMART
PDZ	1622	1697	3.2e-22	SMART
PDZ	1719	1792	3.62e-21	SMART
low complexity region	1798	1815	N/A	INTRINSIC
PDZ	1856	1933	9.79e-18	SMART
PDZ	1980	2055	2.39e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107258
AA Change: I5L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000102879
Gene: ENSMUSG00000028402
AA Change: I5L

Domain	Start	End	E-Value	Type
PDZ	1	73	3.42e-8	SMART
low complexity region	104	119	N/A	INTRINSIC
PDZ	141	224	2.43e-22	SMART
PDZ	306	381	3.41e-17	SMART
low complexity region	394	405	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
PDZ	439	512	2.69e-15	SMART
PDZ	582	657	3.2e-22	SMART
PDZ	679	752	3.62e-21	SMART
low complexity region	758	775	N/A	INTRINSIC
PDZ	816	893	9.79e-18	SMART
PDZ	940	1015	2.39e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107262
AA Change: I5L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000102883
Gene: ENSMUSG00000028402
AA Change: I5L

Domain	Start	End	E-Value	Type
L27	6	66	9.04e-3	SMART
PDZ	147	225	3.03e-23	SMART
PDZ	266	338	8.92e-21	SMART
low complexity region	345	360	N/A	INTRINSIC
PDZ	386	464	6.07e-23	SMART
PDZ	556	627	7.31e-17	SMART
PDZ	701	780	9.94e-19	SMART
PDZ	1004	1080	3.44e-13	SMART
low complexity region	1112	1127	N/A	INTRINSIC
PDZ	1149	1232	2.43e-22	SMART
low complexity region	1234	1252	N/A	INTRINSIC
PDZ	1347	1422	3.41e-17	SMART
low complexity region	1435	1446	N/A	INTRINSIC
low complexity region	1455	1469	N/A	INTRINSIC
PDZ	1480	1553	2.69e-15	SMART
PDZ	1623	1698	3.2e-22	SMART
PDZ	1720	1793	3.62e-21	SMART
low complexity region	1799	1816	N/A	INTRINSIC
PDZ	1857	1934	9.79e-18	SMART
PDZ	1981	2056	2.39e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142273

Predicted Effect

probably benign
Transcript: ENSMUST00000220807
AA Change: I5L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.8%
20x: 90.8%

Validation Efficiency

97% (89/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has multiple PDZ domains, which are hallmarks of protein-protein interactions. The encoded protein is known to interact with the HTR2C receptor and may cause it to clump at the cell surface. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mutant heterozygous mice are more sensitive to ethanol withdrawal effects and consume less alcohol than controls. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700008P02Rik	A	G	3: 6,620,441		probably benign	Het
Aadacl2	C	T	3: 60,010,576	T82I	probably benign	Het
Acadl	T	C	1: 66,853,223	N147S	probably benign	Het
Actr3	A	T	1: 125,408,563	M79K	probably damaging	Het
Agbl3	A	G	6: 34,857,517	S874G	possibly damaging	Het
Aoah	A	T	13: 21,002,948	T472S	probably damaging	Het
Asb16	A	T	11: 102,268,995	D58V	probably damaging	Het
B4galt1	T	C	4: 40,823,575	D172G	probably benign	Het
Bax	T	C	7: 45,465,247	N55S	possibly damaging	Het
Bdkrb2	A	G	12: 105,591,859	N120D	possibly damaging	Het
Bicdl1	T	C	5: 115,651,266		probably benign	Het
Cand1	A	G	10: 119,213,566	L425P	probably damaging	Het
Caskin1	G	A	17: 24,505,478		probably null	Het
Cd248	C	T	19: 5,069,932	P603S	probably benign	Het
Cep95	G	T	11: 106,800,104	R143L	probably benign	Het
Clptm1l	G	T	13: 73,614,673		probably null	Het
Cntnap5a	T	C	1: 116,060,200	F154L	possibly damaging	Het
Cyld	A	T	8: 88,709,990	I303F	possibly damaging	Het
Dock2	A	G	11: 34,706,461	S370P	probably damaging	Het
Enah	G	T	1: 181,922,293	T327K	probably damaging	Het
Farp2	A	T	1: 93,579,860	S427C	probably damaging	Het
Fbxw11	C	T	11: 32,733,612	T301M	probably damaging	Het
Foxc2	A	T	8: 121,117,176	T188S	probably benign	Het
Fzd2	A	G	11: 102,606,328	T533A	probably benign	Het
Glb1l2	G	T	9: 26,769,038	S248*	probably null	Het
Glul	A	T	1: 153,905,538		probably benign	Het
Gm28042	A	G	2: 120,041,406	T946A	probably benign	Het
Golga3	T	A	5: 110,181,783	D2E	probably damaging	Het
Grm1	A	T	10: 10,719,967	F639Y	probably benign	Het
Gzmn	A	G	14: 56,165,911	L247P	probably benign	Het
Hgf	T	G	5: 16,613,785	I525R	probably damaging	Het
Hnrnpul2	T	A	19: 8,831,332	D719E	probably benign	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Itga9	T	C	9: 118,607,117		probably null	Het
Itgb1	T	A	8: 128,705,458	C16S	probably damaging	Het
Itgb1	G	T	8: 128,705,459	C16F	possibly damaging	Het
Kat14	A	G	2: 144,394,100	I251V	probably benign	Het
Kdsr	A	T	1: 106,734,541		probably null	Het
Kif12	T	A	4: 63,166,500	E527V	probably benign	Het
Larp1b	T	C	3: 41,033,474	S44P	probably damaging	Het
Lonp2	T	C	8: 86,673,072		probably benign	Het
Lrp1	C	T	10: 127,605,606	S216N	probably benign	Het
Lrrc19	T	C	4: 94,640,950	S32G	probably benign	Het
Mdm2	G	A	10: 117,690,529	T335M	probably benign	Het
Mettl25	A	G	10: 105,779,632	Y504H	probably damaging	Het
Mill1	T	C	7: 18,245,647	I13T	probably benign	Het
Mmachc	T	A	4: 116,703,524	Q258L	probably benign	Het
Mrps2	C	T	2: 28,469,488	A119V	probably benign	Het
Mtmr11	A	G	3: 96,168,113	T370A	probably benign	Het
Nmi	T	C	2: 51,958,977	I34V	possibly damaging	Het
Obscn	A	T	11: 59,036,075	M5538K	possibly damaging	Het
Ogdhl	T	C	14: 32,325,865	I24T	probably benign	Het
Olfr1477	C	T	19: 13,502,757	T138M	probably benign	Het
Olfr675	A	G	7: 105,024,560	V140A	probably benign	Het
Olfr703	A	G	7: 106,845,196	Y195C	possibly damaging	Het
Olfr816	A	G	10: 129,911,681	V199A	probably benign	Het
Omp	G	T	7: 98,145,359	D20E	probably benign	Het
Otog	A	G	7: 46,283,908	H1291R	probably benign	Het
Pgbd1	A	G	13: 21,423,292	L244P	probably damaging	Het
Ranbp2	A	G	10: 58,463,986	I481V	probably benign	Het
Rbp3	A	T	14: 33,955,792	I566F	probably damaging	Het
Rsph4a	A	G	10: 33,905,529	D125G	probably benign	Het
Scn11a	A	G	9: 119,769,807	V1219A	probably damaging	Het
Serpine3	G	A	14: 62,674,381	G264D	probably benign	Het
Slc4a10	T	C	2: 62,257,462	F400L	probably damaging	Het
Slco1a4	C	T	6: 141,845,447	V8I	probably benign	Het
Soga1	A	T	2: 157,027,637	M1026K	probably benign	Het
Spen	T	C	4: 141,488,024	D499G	unknown	Het
Stk32c	A	G	7: 139,119,015		probably null	Het
Tars	A	G	15: 11,388,175	V485A	probably benign	Het
Tcerg1l	A	G	7: 138,361,767	L258P	probably damaging	Het
Tmc2	A	T	2: 130,247,960	I622F	probably damaging	Het
Tmem183a	A	T	1: 134,354,706	N220K	probably damaging	Het
Tnni3	T	C	7: 4,520,526	D146G	probably damaging	Het
Trappc11	G	T	8: 47,501,680	D908E	probably damaging	Het
Trappc8	A	G	18: 20,863,551	Y436H	probably damaging	Het
Ttc41	G	A	10: 86,776,390	V1176I	probably benign	Het
Ube2b	A	G	11: 51,997,872	V24A	probably benign	Het
Usp30	T	C	5: 114,112,961	C233R	probably damaging	Het
Vmn1r87	T	A	7: 13,131,776	T195S	possibly damaging	Het
Vmn2r24	T	C	6: 123,806,520		probably benign	Het
Vmn2r81	C	A	10: 79,293,024	T583N	probably damaging	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Wdr1	C	A	5: 38,529,972	V239L	probably benign	Het
Wdr17	C	T	8: 54,703,907		probably benign	Het
Zfhx4	A	C	3: 5,241,729	D5A	probably damaging	Het
Zfyve27	T	C	19: 42,171,745		probably null	Het

Other mutations in Mpdz

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Mpdz	APN	4	81310224	nonsense	probably null
IGL00325:Mpdz	APN	4	81317631	missense	probably damaging	1.00
IGL00497:Mpdz	APN	4	81335742	missense	probably benign	0.30
IGL00502:Mpdz	APN	4	81369723	missense	probably damaging	1.00
IGL00539:Mpdz	APN	4	81361351	missense	possibly damaging	0.83
IGL00938:Mpdz	APN	4	81292512	missense	probably damaging	1.00
IGL00990:Mpdz	APN	4	81303584	splice site	probably benign
IGL01394:Mpdz	APN	4	81292491	missense	possibly damaging	0.92
IGL01537:Mpdz	APN	4	81369658	missense	probably damaging	0.98
IGL01558:Mpdz	APN	4	81295530	nonsense	probably null
IGL01561:Mpdz	APN	4	81284614	missense	probably damaging	1.00
IGL01649:Mpdz	APN	4	81303633	missense	probably damaging	0.98
IGL01743:Mpdz	APN	4	81317682	missense	probably damaging	1.00
IGL01941:Mpdz	APN	4	81286387	missense	possibly damaging	0.91
IGL01969:Mpdz	APN	4	81358724	missense	probably damaging	0.98
IGL02023:Mpdz	APN	4	81329529	missense	probably damaging	0.99
IGL02081:Mpdz	APN	4	81335869	missense	probably damaging	1.00
IGL02304:Mpdz	APN	4	81310157	missense	possibly damaging	0.78
IGL02304:Mpdz	APN	4	81297559	splice site	probably benign
IGL02410:Mpdz	APN	4	81297493	missense	probably benign	0.13
IGL02449:Mpdz	APN	4	81329422	splice site	probably null
IGL02671:Mpdz	APN	4	81290273	missense	probably damaging	1.00
IGL02708:Mpdz	APN	4	81284571	splice site	probably null
IGL02718:Mpdz	APN	4	81385202	missense	probably damaging	1.00
IGL03065:Mpdz	APN	4	81292565	missense	probably damaging	0.98
IGL03378:Mpdz	APN	4	81419048	splice site	probably benign
PIT4458001:Mpdz	UTSW	4	81419026	missense	probably damaging	1.00
R0108:Mpdz	UTSW	4	81381805	missense	probably damaging	1.00
R0108:Mpdz	UTSW	4	81381805	missense	probably damaging	1.00
R0119:Mpdz	UTSW	4	81292531	missense	probably benign	0.44
R0402:Mpdz	UTSW	4	81361440	missense	possibly damaging	0.51
R0499:Mpdz	UTSW	4	81292531	missense	probably benign	0.44
R0718:Mpdz	UTSW	4	81292473	missense	possibly damaging	0.79
R0844:Mpdz	UTSW	4	81421194	start gained	probably benign
R0883:Mpdz	UTSW	4	81359991	splice site	probably benign
R0885:Mpdz	UTSW	4	81369592	missense	probably benign	0.04
R1344:Mpdz	UTSW	4	81308319	missense	probably benign	0.01
R1432:Mpdz	UTSW	4	81292551	missense	probably damaging	1.00
R1488:Mpdz	UTSW	4	81348708	nonsense	probably null
R1756:Mpdz	UTSW	4	81306877	missense	possibly damaging	0.87
R1940:Mpdz	UTSW	4	81361443	missense	probably benign	0.01
R2068:Mpdz	UTSW	4	81335830	missense	probably null	1.00
R2182:Mpdz	UTSW	4	81348722	missense	probably damaging	1.00
R2213:Mpdz	UTSW	4	81310172	missense	probably damaging	0.99
R2265:Mpdz	UTSW	4	81383391	missense	probably damaging	1.00
R2268:Mpdz	UTSW	4	81383391	missense	probably damaging	1.00
R2269:Mpdz	UTSW	4	81383391	missense	probably damaging	1.00
R3082:Mpdz	UTSW	4	81285458	splice site	probably benign
R3746:Mpdz	UTSW	4	81363147	missense	probably damaging	1.00
R3902:Mpdz	UTSW	4	81307116	missense	probably damaging	1.00
R4095:Mpdz	UTSW	4	81383823	missense	possibly damaging	0.77
R4097:Mpdz	UTSW	4	81335700	missense	probably damaging	1.00
R4206:Mpdz	UTSW	4	81381762	missense	probably benign	0.13
R4675:Mpdz	UTSW	4	81383812	missense	probably damaging	0.98
R4884:Mpdz	UTSW	4	81361476	missense	probably damaging	0.97
R5044:Mpdz	UTSW	4	81381697	missense	probably benign	0.16
R5050:Mpdz	UTSW	4	81295448	missense	probably benign	0.00
R5243:Mpdz	UTSW	4	81306879	missense	probably damaging	1.00
R5332:Mpdz	UTSW	4	81292580	missense	probably damaging	1.00
R5435:Mpdz	UTSW	4	81283487	intron	probably benign
R5720:Mpdz	UTSW	4	81287694	missense	probably damaging	0.99
R5743:Mpdz	UTSW	4	81421188	start codon destroyed	probably null	0.30
R5764:Mpdz	UTSW	4	81356446	missense	probably benign	0.13
R5876:Mpdz	UTSW	4	81285474	nonsense	probably null
R5938:Mpdz	UTSW	4	81284614	missense	probably damaging	1.00
R5988:Mpdz	UTSW	4	81284575	critical splice donor site	probably null
R6125:Mpdz	UTSW	4	81297527	missense	probably benign	0.00
R6178:Mpdz	UTSW	4	81308365	missense	probably damaging	1.00
R6235:Mpdz	UTSW	4	81385281	missense	probably damaging	1.00
R6293:Mpdz	UTSW	4	81360056	missense	probably damaging	1.00
R6387:Mpdz	UTSW	4	81381709	missense	possibly damaging	0.69
R6488:Mpdz	UTSW	4	81287733	missense	probably benign	0.11
R6536:Mpdz	UTSW	4	81383417	missense	probably damaging	1.00
R6673:Mpdz	UTSW	4	81356430	missense	probably benign	0.11
R6879:Mpdz	UTSW	4	81348656	missense	possibly damaging	0.81
R7180:Mpdz	UTSW	4	81335751	missense	probably damaging	0.98
R7199:Mpdz	UTSW	4	81297333	missense	probably damaging	0.98
R7209:Mpdz	UTSW	4	81306877	missense	possibly damaging	0.87
R7309:Mpdz	UTSW	4	81381958	splice site	probably null
R7359:Mpdz	UTSW	4	81356395	missense	probably benign	0.01
R7561:Mpdz	UTSW	4	81307151	missense	probably damaging	0.99
R7565:Mpdz	UTSW	4	81303654	missense	probably benign	0.01
R7738:Mpdz	UTSW	4	81335749	missense	probably benign	0.01
R7941:Mpdz	UTSW	4	81282750	missense	probably benign	0.04
R8074:Mpdz	UTSW	4	81349087	missense	probably benign	0.00
R8957:Mpdz	UTSW	4	81332979	nonsense	probably null
R8998:Mpdz	UTSW	4	81284645	nonsense	probably null
R8999:Mpdz	UTSW	4	81284645	nonsense	probably null
R9001:Mpdz	UTSW	4	81381762	missense	probably benign
R9223:Mpdz	UTSW	4	81284630	missense	probably damaging	1.00
R9415:Mpdz	UTSW	4	81317668	nonsense	probably null
R9486:Mpdz	UTSW	4	81335806	missense	probably damaging	1.00
R9520:Mpdz	UTSW	4	81386318	missense	probably benign
R9526:Mpdz	UTSW	4	81356416	missense	probably benign
R9556:Mpdz	UTSW	4	81360026	missense	probably damaging	1.00
R9722:Mpdz	UTSW	4	81386267	missense	probably damaging	0.97
RF013:Mpdz	UTSW	4	81293592	missense	possibly damaging	0.60
X0011:Mpdz	UTSW	4	81292759	critical splice donor site	probably null
Z1177:Mpdz	UTSW	4	81320490	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGGTAACAATGTGGATAAAACTGCACGA -3'
(R):5'- GCTGCCCAGCACACTGTGA -3'

Sequencing Primer
(F):5'- TGCACGAATAGAGAAATCCACTAC -3'
(R):5'- gctgggatttgaactctggac -3'

Posted On

2014-04-24