Incidental Mutation 'R1589:Mmachc'
ID177707
Institutional Source Beutler Lab
Gene Symbol Mmachc
Ensembl Gene ENSMUSG00000028690
Gene Namemethylmalonic aciduria cblC type, with homocystinuria
Synonyms1810037K07Rik
MMRRC Submission 039626-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R1589 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116702279-116708406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116703524 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 258 (Q258L)
Ref Sequence ENSEMBL: ENSMUSP00000030453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030452] [ENSMUST00000030453] [ENSMUST00000030454] [ENSMUST00000106470] [ENSMUST00000135573]
Predicted Effect probably benign
Transcript: ENSMUST00000030452
SMART Domains Protein: ENSMUSP00000030452
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
coiled coil region 112 144 N/A INTRINSIC
coiled coil region 165 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030453
AA Change: Q258L

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000030453
Gene: ENSMUSG00000028690
AA Change: Q258L

DomainStartEndE-ValueType
Pfam:MMACHC 20 234 9.5e-102 PFAM
low complexity region 243 257 N/A INTRINSIC
low complexity region 268 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030454
SMART Domains Protein: ENSMUSP00000030454
Gene: ENSMUSG00000028691

DomainStartEndE-ValueType
Pfam:Redoxin 7 158 1.1e-18 PFAM
Pfam:AhpC-TSA 8 142 9e-44 PFAM
Pfam:1-cysPrx_C 162 176 8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106470
SMART Domains Protein: ENSMUSP00000102078
Gene: ENSMUSG00000028691

DomainStartEndE-ValueType
Pfam:Redoxin 7 157 2.7e-17 PFAM
Pfam:AhpC-TSA 8 142 6.1e-42 PFAM
Pfam:1-cysPrx_C 162 197 2.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135573
SMART Domains Protein: ENSMUSP00000114159
Gene: ENSMUSG00000028691

DomainStartEndE-ValueType
Pfam:Redoxin 7 158 3.8e-18 PFAM
Pfam:AhpC-TSA 8 142 2.8e-43 PFAM
Pfam:1-cysPrx_C 162 197 2.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143330
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The exact function of the protein encoded by this gene is not known, however, its C-terminal region shows similarity to TonB, a bacterial protein involved in energy transduction for cobalamin (vitamin B12) uptake. Hence, it is postulated that this protein may have a role in the binding and intracellular trafficking of cobalamin. Mutations in this gene are associated with methylmalonic aciduria and homocystinuria type cblC. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,441 probably benign Het
Aadacl2 C T 3: 60,010,576 T82I probably benign Het
Acadl T C 1: 66,853,223 N147S probably benign Het
Actr3 A T 1: 125,408,563 M79K probably damaging Het
Agbl3 A G 6: 34,857,517 S874G possibly damaging Het
Aoah A T 13: 21,002,948 T472S probably damaging Het
Asb16 A T 11: 102,268,995 D58V probably damaging Het
B4galt1 T C 4: 40,823,575 D172G probably benign Het
Bax T C 7: 45,465,247 N55S possibly damaging Het
Bdkrb2 A G 12: 105,591,859 N120D possibly damaging Het
Bicdl1 T C 5: 115,651,266 probably benign Het
Cand1 A G 10: 119,213,566 L425P probably damaging Het
Caskin1 G A 17: 24,505,478 probably null Het
Cd248 C T 19: 5,069,932 P603S probably benign Het
Cep95 G T 11: 106,800,104 R143L probably benign Het
Clptm1l G T 13: 73,614,673 probably null Het
Cntnap5a T C 1: 116,060,200 F154L possibly damaging Het
Cyld A T 8: 88,709,990 I303F possibly damaging Het
Dock2 A G 11: 34,706,461 S370P probably damaging Het
Enah G T 1: 181,922,293 T327K probably damaging Het
Farp2 A T 1: 93,579,860 S427C probably damaging Het
Fbxw11 C T 11: 32,733,612 T301M probably damaging Het
Foxc2 A T 8: 121,117,176 T188S probably benign Het
Fzd2 A G 11: 102,606,328 T533A probably benign Het
Glb1l2 G T 9: 26,769,038 S248* probably null Het
Glul A T 1: 153,905,538 probably benign Het
Gm28042 A G 2: 120,041,406 T946A probably benign Het
Golga3 T A 5: 110,181,783 D2E probably damaging Het
Grm1 A T 10: 10,719,967 F639Y probably benign Het
Gzmn A G 14: 56,165,911 L247P probably benign Het
Hgf T G 5: 16,613,785 I525R probably damaging Het
Hnrnpul2 T A 19: 8,831,332 D719E probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itga9 T C 9: 118,607,117 probably null Het
Itgb1 T A 8: 128,705,458 C16S probably damaging Het
Itgb1 G T 8: 128,705,459 C16F possibly damaging Het
Kat14 A G 2: 144,394,100 I251V probably benign Het
Kdsr A T 1: 106,734,541 probably null Het
Kif12 T A 4: 63,166,500 E527V probably benign Het
Larp1b T C 3: 41,033,474 S44P probably damaging Het
Lonp2 T C 8: 86,673,072 probably benign Het
Lrp1 C T 10: 127,605,606 S216N probably benign Het
Lrrc19 T C 4: 94,640,950 S32G probably benign Het
Mdm2 G A 10: 117,690,529 T335M probably benign Het
Mettl25 A G 10: 105,779,632 Y504H probably damaging Het
Mill1 T C 7: 18,245,647 I13T probably benign Het
Mpdz T A 4: 81,421,176 I5L probably benign Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Mtmr11 A G 3: 96,168,113 T370A probably benign Het
Nmi T C 2: 51,958,977 I34V possibly damaging Het
Obscn A T 11: 59,036,075 M5538K possibly damaging Het
Ogdhl T C 14: 32,325,865 I24T probably benign Het
Olfr1477 C T 19: 13,502,757 T138M probably benign Het
Olfr675 A G 7: 105,024,560 V140A probably benign Het
Olfr703 A G 7: 106,845,196 Y195C possibly damaging Het
Olfr816 A G 10: 129,911,681 V199A probably benign Het
Omp G T 7: 98,145,359 D20E probably benign Het
Otog A G 7: 46,283,908 H1291R probably benign Het
Pgbd1 A G 13: 21,423,292 L244P probably damaging Het
Ranbp2 A G 10: 58,463,986 I481V probably benign Het
Rbp3 A T 14: 33,955,792 I566F probably damaging Het
Rsph4a A G 10: 33,905,529 D125G probably benign Het
Scn11a A G 9: 119,769,807 V1219A probably damaging Het
Serpine3 G A 14: 62,674,381 G264D probably benign Het
Slc4a10 T C 2: 62,257,462 F400L probably damaging Het
Slco1a4 C T 6: 141,845,447 V8I probably benign Het
Soga1 A T 2: 157,027,637 M1026K probably benign Het
Spen T C 4: 141,488,024 D499G unknown Het
Stk32c A G 7: 139,119,015 probably null Het
Tars A G 15: 11,388,175 V485A probably benign Het
Tcerg1l A G 7: 138,361,767 L258P probably damaging Het
Tmc2 A T 2: 130,247,960 I622F probably damaging Het
Tmem183a A T 1: 134,354,706 N220K probably damaging Het
Tnni3 T C 7: 4,520,526 D146G probably damaging Het
Trappc11 G T 8: 47,501,680 D908E probably damaging Het
Trappc8 A G 18: 20,863,551 Y436H probably damaging Het
Ttc41 G A 10: 86,776,390 V1176I probably benign Het
Ube2b A G 11: 51,997,872 V24A probably benign Het
Usp30 T C 5: 114,112,961 C233R probably damaging Het
Vmn1r87 T A 7: 13,131,776 T195S possibly damaging Het
Vmn2r24 T C 6: 123,806,520 probably benign Het
Vmn2r81 C A 10: 79,293,024 T583N probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr1 C A 5: 38,529,972 V239L probably benign Het
Wdr17 C T 8: 54,703,907 probably benign Het
Zfhx4 A C 3: 5,241,729 D5A probably damaging Het
Zfyve27 T C 19: 42,171,745 probably null Het
Other mutations in Mmachc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Mmachc APN 4 116705921 missense probably damaging 1.00
IGL02014:Mmachc APN 4 116703710 missense probably damaging 1.00
R0242:Mmachc UTSW 4 116704541 missense probably damaging 0.97
R0242:Mmachc UTSW 4 116704541 missense probably damaging 0.97
R0646:Mmachc UTSW 4 116703654 missense probably damaging 1.00
R1413:Mmachc UTSW 4 116705997 missense probably damaging 0.97
R4037:Mmachc UTSW 4 116706018 missense probably damaging 0.99
R4038:Mmachc UTSW 4 116706018 missense probably damaging 0.99
R4039:Mmachc UTSW 4 116706018 missense probably damaging 0.99
R4627:Mmachc UTSW 4 116703471 missense probably damaging 0.97
R5557:Mmachc UTSW 4 116705900 missense probably damaging 0.96
R6749:Mmachc UTSW 4 116704541 missense probably damaging 1.00
R7541:Mmachc UTSW 4 116705885 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATTGAGTCTTGACTGTCTGAAGCACT -3'
(R):5'- CCGTGATGCTGTGACTCCTGAAGAA -3'

Sequencing Primer
(F):5'- gagaagacagaggcagatgg -3'
(R):5'- GTGACTCCTGAAGAACGGTACTC -3'
Posted On2014-04-24