Mutagenetix > Incidental Mutation

Incidental Mutation 'R1589:Hgf'

177710

Institutional Source

Beutler Lab

Gene Symbol

Hgf

Ensembl Gene

ENSMUSG00000028864

Gene Name

hepatocyte growth factor

Synonyms

HGF/SF, NK1, C230052L06Rik, scatter factor, NK2, SF/HGF

MMRRC Submission

039626-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1589 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16553495-16620152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 16613785 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Arginine at position 525 (I525R)

Ref Sequence

ENSEMBL: ENSMUSP00000143424 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030683] [ENSMUST00000196645] [ENSMUST00000199581]

AlphaFold

Q08048

Predicted Effect

probably damaging
Transcript: ENSMUST00000030683
AA Change: I525R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030683
Gene: ENSMUSG00000028864
AA Change: I525R

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
PAN_AP	38	123	6.47e-13	SMART
KR	127	209	3.03e-46	SMART
KR	210	291	9.04e-45	SMART
KR	304	386	7.35e-45	SMART
KR	390	472	1.02e-38	SMART
Tryp_SPc	495	719	5.6e-55	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000196645
AA Change: I520R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142517
Gene: ENSMUSG00000028864
AA Change: I520R

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
PAN_AP	38	123	6.47e-13	SMART
KR	127	204	3.76e-42	SMART
KR	205	286	9.04e-45	SMART
KR	299	381	7.35e-45	SMART
KR	385	467	1.02e-38	SMART
Tryp_SPc	490	714	5.6e-55	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000199581
AA Change: I525R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143424
Gene: ENSMUSG00000028864
AA Change: I525R

Domain	Start	End	E-Value	Type
low complexity region	7	25	N/A	INTRINSIC
PAN_AP	38	123	6.47e-13	SMART
KR	127	209	3.03e-46	SMART
KR	210	291	9.04e-45	SMART
KR	304	386	7.35e-45	SMART
KR	390	472	1.02e-38	SMART
Tryp_SPc	495	719	5.6e-55	SMART

Meta Mutation Damage Score

0.8279

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.8%
20x: 90.8%

Validation Efficiency

97% (89/92)

MGI Phenotype

FUNCTION: This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the hepatocyte growth factor alpha and beta chains, which heterodimerize to form the mature active protein. Although this protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Homozygous knockout mice for this gene exhibit embryonic lethality due to impaired development of the placenta and liver. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced embryonic livers, impaired migration of dermomyotome precursors affecting skeletal muscle formation, defective navigation of hypoglossal motor axons, abnormal placentas, and prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700008P02Rik	A	G	3: 6,620,441		probably benign	Het
Aadacl2	C	T	3: 60,010,576	T82I	probably benign	Het
Acadl	T	C	1: 66,853,223	N147S	probably benign	Het
Actr3	A	T	1: 125,408,563	M79K	probably damaging	Het
Agbl3	A	G	6: 34,857,517	S874G	possibly damaging	Het
Aoah	A	T	13: 21,002,948	T472S	probably damaging	Het
Asb16	A	T	11: 102,268,995	D58V	probably damaging	Het
B4galt1	T	C	4: 40,823,575	D172G	probably benign	Het
Bax	T	C	7: 45,465,247	N55S	possibly damaging	Het
Bdkrb2	A	G	12: 105,591,859	N120D	possibly damaging	Het
Bicdl1	T	C	5: 115,651,266		probably benign	Het
Cand1	A	G	10: 119,213,566	L425P	probably damaging	Het
Caskin1	G	A	17: 24,505,478		probably null	Het
Cd248	C	T	19: 5,069,932	P603S	probably benign	Het
Cep95	G	T	11: 106,800,104	R143L	probably benign	Het
Clptm1l	G	T	13: 73,614,673		probably null	Het
Cntnap5a	T	C	1: 116,060,200	F154L	possibly damaging	Het
Cyld	A	T	8: 88,709,990	I303F	possibly damaging	Het
Dock2	A	G	11: 34,706,461	S370P	probably damaging	Het
Enah	G	T	1: 181,922,293	T327K	probably damaging	Het
Farp2	A	T	1: 93,579,860	S427C	probably damaging	Het
Fbxw11	C	T	11: 32,733,612	T301M	probably damaging	Het
Foxc2	A	T	8: 121,117,176	T188S	probably benign	Het
Fzd2	A	G	11: 102,606,328	T533A	probably benign	Het
Glb1l2	G	T	9: 26,769,038	S248*	probably null	Het
Glul	A	T	1: 153,905,538		probably benign	Het
Gm28042	A	G	2: 120,041,406	T946A	probably benign	Het
Golga3	T	A	5: 110,181,783	D2E	probably damaging	Het
Grm1	A	T	10: 10,719,967	F639Y	probably benign	Het
Gzmn	A	G	14: 56,165,911	L247P	probably benign	Het
Hnrnpul2	T	A	19: 8,831,332	D719E	probably benign	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Itga9	T	C	9: 118,607,117		probably null	Het
Itgb1	T	A	8: 128,705,458	C16S	probably damaging	Het
Itgb1	G	T	8: 128,705,459	C16F	possibly damaging	Het
Kat14	A	G	2: 144,394,100	I251V	probably benign	Het
Kdsr	A	T	1: 106,734,541		probably null	Het
Kif12	T	A	4: 63,166,500	E527V	probably benign	Het
Larp1b	T	C	3: 41,033,474	S44P	probably damaging	Het
Lonp2	T	C	8: 86,673,072		probably benign	Het
Lrp1	C	T	10: 127,605,606	S216N	probably benign	Het
Lrrc19	T	C	4: 94,640,950	S32G	probably benign	Het
Mdm2	G	A	10: 117,690,529	T335M	probably benign	Het
Mettl25	A	G	10: 105,779,632	Y504H	probably damaging	Het
Mill1	T	C	7: 18,245,647	I13T	probably benign	Het
Mmachc	T	A	4: 116,703,524	Q258L	probably benign	Het
Mpdz	T	A	4: 81,421,176	I5L	probably benign	Het
Mrps2	C	T	2: 28,469,488	A119V	probably benign	Het
Mtmr11	A	G	3: 96,168,113	T370A	probably benign	Het
Nmi	T	C	2: 51,958,977	I34V	possibly damaging	Het
Obscn	A	T	11: 59,036,075	M5538K	possibly damaging	Het
Ogdhl	T	C	14: 32,325,865	I24T	probably benign	Het
Olfr1477	C	T	19: 13,502,757	T138M	probably benign	Het
Olfr675	A	G	7: 105,024,560	V140A	probably benign	Het
Olfr703	A	G	7: 106,845,196	Y195C	possibly damaging	Het
Olfr816	A	G	10: 129,911,681	V199A	probably benign	Het
Omp	G	T	7: 98,145,359	D20E	probably benign	Het
Otog	A	G	7: 46,283,908	H1291R	probably benign	Het
Pgbd1	A	G	13: 21,423,292	L244P	probably damaging	Het
Ranbp2	A	G	10: 58,463,986	I481V	probably benign	Het
Rbp3	A	T	14: 33,955,792	I566F	probably damaging	Het
Rsph4a	A	G	10: 33,905,529	D125G	probably benign	Het
Scn11a	A	G	9: 119,769,807	V1219A	probably damaging	Het
Serpine3	G	A	14: 62,674,381	G264D	probably benign	Het
Slc4a10	T	C	2: 62,257,462	F400L	probably damaging	Het
Slco1a4	C	T	6: 141,845,447	V8I	probably benign	Het
Soga1	A	T	2: 157,027,637	M1026K	probably benign	Het
Spen	T	C	4: 141,488,024	D499G	unknown	Het
Stk32c	A	G	7: 139,119,015		probably null	Het
Tars	A	G	15: 11,388,175	V485A	probably benign	Het
Tcerg1l	A	G	7: 138,361,767	L258P	probably damaging	Het
Tmc2	A	T	2: 130,247,960	I622F	probably damaging	Het
Tmem183a	A	T	1: 134,354,706	N220K	probably damaging	Het
Tnni3	T	C	7: 4,520,526	D146G	probably damaging	Het
Trappc11	G	T	8: 47,501,680	D908E	probably damaging	Het
Trappc8	A	G	18: 20,863,551	Y436H	probably damaging	Het
Ttc41	G	A	10: 86,776,390	V1176I	probably benign	Het
Ube2b	A	G	11: 51,997,872	V24A	probably benign	Het
Usp30	T	C	5: 114,112,961	C233R	probably damaging	Het
Vmn1r87	T	A	7: 13,131,776	T195S	possibly damaging	Het
Vmn2r24	T	C	6: 123,806,520		probably benign	Het
Vmn2r81	C	A	10: 79,293,024	T583N	probably damaging	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Wdr1	C	A	5: 38,529,972	V239L	probably benign	Het
Wdr17	C	T	8: 54,703,907		probably benign	Het
Zfhx4	A	C	3: 5,241,729	D5A	probably damaging	Het
Zfyve27	T	C	19: 42,171,745		probably null	Het

Other mutations in Hgf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Hgf	APN	5	16611882	missense	possibly damaging	0.70
IGL00427:Hgf	APN	5	16578486	missense	probably benign	0.09
IGL00788:Hgf	APN	5	16598230	missense	probably damaging	0.99
IGL01290:Hgf	APN	5	16604846	missense	probably damaging	1.00
IGL01333:Hgf	APN	5	16576941	nonsense	probably null
IGL01568:Hgf	APN	5	16564814	missense	probably damaging	1.00
IGL02314:Hgf	APN	5	16572602	missense	probably damaging	0.99
IGL02328:Hgf	APN	5	16598221	missense	probably damaging	1.00
IGL02368:Hgf	APN	5	16564794	missense	possibly damaging	0.95
IGL02486:Hgf	APN	5	16602289	missense	probably damaging	1.00
IGL02654:Hgf	APN	5	16561051	missense	probably benign
Foiegras	UTSW	5	16615802	missense	probably benign	0.01
PIT4378001:Hgf	UTSW	5	16611862	missense	probably damaging	1.00
R0708:Hgf	UTSW	5	16566763	nonsense	probably null
R0710:Hgf	UTSW	5	16566763	nonsense	probably null
R0718:Hgf	UTSW	5	16593859	missense	probably damaging	1.00
R0967:Hgf	UTSW	5	16593841	splice site	probably benign
R1181:Hgf	UTSW	5	16618925	missense	probably damaging	1.00
R1705:Hgf	UTSW	5	16615802	missense	probably benign	0.01
R1983:Hgf	UTSW	5	16561012	missense	possibly damaging	0.53
R2021:Hgf	UTSW	5	16576921	missense	probably benign
R2441:Hgf	UTSW	5	16604790	missense	probably damaging	0.99
R4083:Hgf	UTSW	5	16615858	nonsense	probably null
R4084:Hgf	UTSW	5	16615858	nonsense	probably null
R4211:Hgf	UTSW	5	16614993	missense	probably damaging	0.99
R4388:Hgf	UTSW	5	16614943	missense	probably benign	0.12
R4394:Hgf	UTSW	5	16618951	nonsense	probably null
R4575:Hgf	UTSW	5	16572601	missense	probably benign
R5044:Hgf	UTSW	5	16614894	missense	probably benign	0.00
R5319:Hgf	UTSW	5	16566862	critical splice donor site	probably null
R5585:Hgf	UTSW	5	16564801	missense	possibly damaging	0.93
R5700:Hgf	UTSW	5	16610124	missense	probably damaging	1.00
R5814:Hgf	UTSW	5	16602307	missense	probably benign	0.19
R6125:Hgf	UTSW	5	16598161	missense	probably damaging	1.00
R6749:Hgf	UTSW	5	16613642	splice site	probably null
R6891:Hgf	UTSW	5	16604922	critical splice donor site	probably null
R6962:Hgf	UTSW	5	16615754	missense	probably benign	0.32
R7251:Hgf	UTSW	5	16593944	missense	possibly damaging	0.95
R7296:Hgf	UTSW	5	16564843	missense	probably benign	0.39
R7463:Hgf	UTSW	5	16578450	missense	probably benign	0.00
R7470:Hgf	UTSW	5	16618856	missense	probably benign	0.02
R7630:Hgf	UTSW	5	16598250	missense	probably benign	0.01
R7807:Hgf	UTSW	5	16577011	missense	probably damaging	0.99
R8098:Hgf	UTSW	5	16561061	missense	probably benign	0.04
R8120:Hgf	UTSW	5	16613781	missense	probably damaging	1.00
R8132:Hgf	UTSW	5	16602331	missense	probably damaging	1.00
R8499:Hgf	UTSW	5	16566856	missense	probably damaging	0.99
R8929:Hgf	UTSW	5	16593990	missense	probably benign	0.44
R9016:Hgf	UTSW	5	16618958	missense	probably damaging	1.00
R9126:Hgf	UTSW	5	16560981	missense	possibly damaging	0.95
R9197:Hgf	UTSW	5	16561061	missense	probably benign	0.04
R9347:Hgf	UTSW	5	16604923	critical splice donor site	probably null
R9478:Hgf	UTSW	5	16561031	missense	possibly damaging	0.70
R9696:Hgf	UTSW	5	16572536	missense	probably damaging	1.00
R9729:Hgf	UTSW	5	16561031	missense	probably damaging	0.97
R9732:Hgf	UTSW	5	16615750	missense	probably damaging	1.00
X0024:Hgf	UTSW	5	16604828	missense	probably damaging	1.00
Z1088:Hgf	UTSW	5	16618919	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGTTGTGTGTCTTGTTCCAACTGA -3'
(R):5'- GGGAAGCAGGGGCATGATTTGTTTA -3'

Sequencing Primer
(F):5'- CCATTGGATAACTAACTGGGCAG -3'
(R):5'- cacacacacacacacacac -3'

Posted On

2014-04-24