Mutagenetix > Incidental Mutation

Incidental Mutation 'R1589:Agbl3'

177716

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

039626-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1589 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34857517 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 874 (S874G)

Ref Sequence

ENSEMBL: ENSMUSP00000110669 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115016
AA Change: S879G

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: S879G

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115017
AA Change: S874G

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: S874G

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202329

Meta Mutation Damage Score

0.0711

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.8%
20x: 90.8%

Validation Efficiency

97% (89/92)

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700008P02Rik	A	G	3: 6,620,441		probably benign	Het
Aadacl2	C	T	3: 60,010,576	T82I	probably benign	Het
Acadl	T	C	1: 66,853,223	N147S	probably benign	Het
Actr3	A	T	1: 125,408,563	M79K	probably damaging	Het
Aoah	A	T	13: 21,002,948	T472S	probably damaging	Het
Asb16	A	T	11: 102,268,995	D58V	probably damaging	Het
B4galt1	T	C	4: 40,823,575	D172G	probably benign	Het
Bax	T	C	7: 45,465,247	N55S	possibly damaging	Het
Bdkrb2	A	G	12: 105,591,859	N120D	possibly damaging	Het
Bicdl1	T	C	5: 115,651,266		probably benign	Het
Cand1	A	G	10: 119,213,566	L425P	probably damaging	Het
Caskin1	G	A	17: 24,505,478		probably null	Het
Cd248	C	T	19: 5,069,932	P603S	probably benign	Het
Cep95	G	T	11: 106,800,104	R143L	probably benign	Het
Clptm1l	G	T	13: 73,614,673		probably null	Het
Cntnap5a	T	C	1: 116,060,200	F154L	possibly damaging	Het
Cyld	A	T	8: 88,709,990	I303F	possibly damaging	Het
Dock2	A	G	11: 34,706,461	S370P	probably damaging	Het
Enah	G	T	1: 181,922,293	T327K	probably damaging	Het
Farp2	A	T	1: 93,579,860	S427C	probably damaging	Het
Fbxw11	C	T	11: 32,733,612	T301M	probably damaging	Het
Foxc2	A	T	8: 121,117,176	T188S	probably benign	Het
Fzd2	A	G	11: 102,606,328	T533A	probably benign	Het
Glb1l2	G	T	9: 26,769,038	S248*	probably null	Het
Glul	A	T	1: 153,905,538		probably benign	Het
Gm28042	A	G	2: 120,041,406	T946A	probably benign	Het
Golga3	T	A	5: 110,181,783	D2E	probably damaging	Het
Grm1	A	T	10: 10,719,967	F639Y	probably benign	Het
Gzmn	A	G	14: 56,165,911	L247P	probably benign	Het
Hgf	T	G	5: 16,613,785	I525R	probably damaging	Het
Hnrnpul2	T	A	19: 8,831,332	D719E	probably benign	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Itga9	T	C	9: 118,607,117		probably null	Het
Itgb1	T	A	8: 128,705,458	C16S	probably damaging	Het
Itgb1	G	T	8: 128,705,459	C16F	possibly damaging	Het
Kat14	A	G	2: 144,394,100	I251V	probably benign	Het
Kdsr	A	T	1: 106,734,541		probably null	Het
Kif12	T	A	4: 63,166,500	E527V	probably benign	Het
Larp1b	T	C	3: 41,033,474	S44P	probably damaging	Het
Lonp2	T	C	8: 86,673,072		probably benign	Het
Lrp1	C	T	10: 127,605,606	S216N	probably benign	Het
Lrrc19	T	C	4: 94,640,950	S32G	probably benign	Het
Mdm2	G	A	10: 117,690,529	T335M	probably benign	Het
Mettl25	A	G	10: 105,779,632	Y504H	probably damaging	Het
Mill1	T	C	7: 18,245,647	I13T	probably benign	Het
Mmachc	T	A	4: 116,703,524	Q258L	probably benign	Het
Mpdz	T	A	4: 81,421,176	I5L	probably benign	Het
Mrps2	C	T	2: 28,469,488	A119V	probably benign	Het
Mtmr11	A	G	3: 96,168,113	T370A	probably benign	Het
Nmi	T	C	2: 51,958,977	I34V	possibly damaging	Het
Obscn	A	T	11: 59,036,075	M5538K	possibly damaging	Het
Ogdhl	T	C	14: 32,325,865	I24T	probably benign	Het
Olfr1477	C	T	19: 13,502,757	T138M	probably benign	Het
Olfr675	A	G	7: 105,024,560	V140A	probably benign	Het
Olfr703	A	G	7: 106,845,196	Y195C	possibly damaging	Het
Olfr816	A	G	10: 129,911,681	V199A	probably benign	Het
Omp	G	T	7: 98,145,359	D20E	probably benign	Het
Otog	A	G	7: 46,283,908	H1291R	probably benign	Het
Pgbd1	A	G	13: 21,423,292	L244P	probably damaging	Het
Ranbp2	A	G	10: 58,463,986	I481V	probably benign	Het
Rbp3	A	T	14: 33,955,792	I566F	probably damaging	Het
Rsph4a	A	G	10: 33,905,529	D125G	probably benign	Het
Scn11a	A	G	9: 119,769,807	V1219A	probably damaging	Het
Serpine3	G	A	14: 62,674,381	G264D	probably benign	Het
Slc4a10	T	C	2: 62,257,462	F400L	probably damaging	Het
Slco1a4	C	T	6: 141,845,447	V8I	probably benign	Het
Soga1	A	T	2: 157,027,637	M1026K	probably benign	Het
Spen	T	C	4: 141,488,024	D499G	unknown	Het
Stk32c	A	G	7: 139,119,015		probably null	Het
Tars	A	G	15: 11,388,175	V485A	probably benign	Het
Tcerg1l	A	G	7: 138,361,767	L258P	probably damaging	Het
Tmc2	A	T	2: 130,247,960	I622F	probably damaging	Het
Tmem183a	A	T	1: 134,354,706	N220K	probably damaging	Het
Tnni3	T	C	7: 4,520,526	D146G	probably damaging	Het
Trappc11	G	T	8: 47,501,680	D908E	probably damaging	Het
Trappc8	A	G	18: 20,863,551	Y436H	probably damaging	Het
Ttc41	G	A	10: 86,776,390	V1176I	probably benign	Het
Ube2b	A	G	11: 51,997,872	V24A	probably benign	Het
Usp30	T	C	5: 114,112,961	C233R	probably damaging	Het
Vmn1r87	T	A	7: 13,131,776	T195S	possibly damaging	Het
Vmn2r24	T	C	6: 123,806,520		probably benign	Het
Vmn2r81	C	A	10: 79,293,024	T583N	probably damaging	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Wdr1	C	A	5: 38,529,972	V239L	probably benign	Het
Wdr17	C	T	8: 54,703,907		probably benign	Het
Zfhx4	A	C	3: 5,241,729	D5A	probably damaging	Het
Zfyve27	T	C	19: 42,171,745		probably null	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAAACACTTAGAACCAGGGATGAAGAC -3'
(R):5'- GCTGGTGGCAAGCTGCACA -3'

Sequencing Primer
(F):5'- caccccccctatctccc -3'
(R):5'- GGCAAGCTGCACATCCTTAG -3'

Posted On

2014-04-24