Incidental Mutation 'R1589:Stk32c'
ID 177728
Institutional Source Beutler Lab
Gene Symbol Stk32c
Ensembl Gene ENSMUSG00000015981
Gene Name serine/threonine kinase 32C
Synonyms Pkek, YANK3
MMRRC Submission 039626-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1589 (G1)
Quality Score 195
Status Validated
Chromosome 7
Chromosomal Location 138683554-138793223 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 138698931 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016125] [ENSMUST00000016125] [ENSMUST00000165870] [ENSMUST00000165870]
AlphaFold Q8QZV4
Predicted Effect probably null
Transcript: ENSMUST00000016125
SMART Domains Protein: ENSMUSP00000016125
Gene: ENSMUSG00000015981

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 32 48 N/A INTRINSIC
low complexity region 62 80 N/A INTRINSIC
S_TKc 94 354 9.16e-82 SMART
low complexity region 398 407 N/A INTRINSIC
low complexity region 408 418 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000016125
SMART Domains Protein: ENSMUSP00000016125
Gene: ENSMUSG00000015981

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 32 48 N/A INTRINSIC
low complexity region 62 80 N/A INTRINSIC
S_TKc 94 354 9.16e-82 SMART
low complexity region 398 407 N/A INTRINSIC
low complexity region 408 418 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165870
SMART Domains Protein: ENSMUSP00000126638
Gene: ENSMUSG00000015981

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 232 1.2e-30 PFAM
Pfam:Pkinase 1 235 1.5e-51 PFAM
Pfam:Kinase-like 12 223 6.2e-13 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 290 300 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165870
SMART Domains Protein: ENSMUSP00000126638
Gene: ENSMUSG00000015981

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 232 1.2e-30 PFAM
Pfam:Pkinase 1 235 1.5e-51 PFAM
Pfam:Kinase-like 12 223 6.2e-13 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 290 300 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. It is thought that this family member is functional in brain due to its high expression levels there. DNA methylation differences have been found in this gene in monozygotic twins that are discordant for adolescent depression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,685,501 (GRCm39) probably benign Het
Aadacl2 C T 3: 59,917,997 (GRCm39) T82I probably benign Het
Acadl T C 1: 66,892,382 (GRCm39) N147S probably benign Het
Actr3 A T 1: 125,336,300 (GRCm39) M79K probably damaging Het
Agbl3 A G 6: 34,834,452 (GRCm39) S874G possibly damaging Het
Aoah A T 13: 21,187,118 (GRCm39) T472S probably damaging Het
Asb16 A T 11: 102,159,821 (GRCm39) D58V probably damaging Het
B4galt1 T C 4: 40,823,575 (GRCm39) D172G probably benign Het
Bax T C 7: 45,114,671 (GRCm39) N55S possibly damaging Het
Bdkrb2 A G 12: 105,558,118 (GRCm39) N120D possibly damaging Het
Bicdl1 T C 5: 115,789,325 (GRCm39) probably benign Het
Cand1 A G 10: 119,049,471 (GRCm39) L425P probably damaging Het
Caskin1 G A 17: 24,724,452 (GRCm39) probably null Het
Cd248 C T 19: 5,119,960 (GRCm39) P603S probably benign Het
Cep95 G T 11: 106,690,930 (GRCm39) R143L probably benign Het
Clptm1l G T 13: 73,762,792 (GRCm39) probably null Het
Cntnap5a T C 1: 115,987,930 (GRCm39) F154L possibly damaging Het
Cyld A T 8: 89,436,618 (GRCm39) I303F possibly damaging Het
Dock2 A G 11: 34,597,288 (GRCm39) S370P probably damaging Het
Enah G T 1: 181,749,858 (GRCm39) T327K probably damaging Het
Farp2 A T 1: 93,507,582 (GRCm39) S427C probably damaging Het
Fbxw11 C T 11: 32,683,612 (GRCm39) T301M probably damaging Het
Foxc2 A T 8: 121,843,915 (GRCm39) T188S probably benign Het
Fzd2 A G 11: 102,497,154 (GRCm39) T533A probably benign Het
Glb1l2 G T 9: 26,680,334 (GRCm39) S248* probably null Het
Glul A T 1: 153,781,284 (GRCm39) probably benign Het
Gm28042 A G 2: 119,871,887 (GRCm39) T946A probably benign Het
Golga3 T A 5: 110,329,649 (GRCm39) D2E probably damaging Het
Grm1 A T 10: 10,595,711 (GRCm39) F639Y probably benign Het
Gzmn A G 14: 56,403,368 (GRCm39) L247P probably benign Het
Hgf T G 5: 16,818,783 (GRCm39) I525R probably damaging Het
Hnrnpul2 T A 19: 8,808,696 (GRCm39) D719E probably benign Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Itga9 T C 9: 118,436,185 (GRCm39) probably null Het
Itgb1 T A 8: 129,431,939 (GRCm39) C16S probably damaging Het
Itgb1 G T 8: 129,431,940 (GRCm39) C16F possibly damaging Het
Kat14 A G 2: 144,236,020 (GRCm39) I251V probably benign Het
Kdsr A T 1: 106,662,271 (GRCm39) probably null Het
Kif12 T A 4: 63,084,737 (GRCm39) E527V probably benign Het
Larp1b T C 3: 40,987,909 (GRCm39) S44P probably damaging Het
Lonp2 T C 8: 87,399,700 (GRCm39) probably benign Het
Lrp1 C T 10: 127,441,475 (GRCm39) S216N probably benign Het
Lrrc19 T C 4: 94,529,187 (GRCm39) S32G probably benign Het
Mdm2 G A 10: 117,526,434 (GRCm39) T335M probably benign Het
Mettl25 A G 10: 105,615,493 (GRCm39) Y504H probably damaging Het
Mill1 T C 7: 17,979,572 (GRCm39) I13T probably benign Het
Mmachc T A 4: 116,560,721 (GRCm39) Q258L probably benign Het
Mpdz T A 4: 81,339,413 (GRCm39) I5L probably benign Het
Mrps2 C T 2: 28,359,500 (GRCm39) A119V probably benign Het
Mtcl2 A T 2: 156,869,557 (GRCm39) M1026K probably benign Het
Mtmr11 A G 3: 96,075,429 (GRCm39) T370A probably benign Het
Nmi T C 2: 51,848,989 (GRCm39) I34V possibly damaging Het
Obscn A T 11: 58,926,901 (GRCm39) M5538K possibly damaging Het
Ogdhl T C 14: 32,047,822 (GRCm39) I24T probably benign Het
Omp G T 7: 97,794,566 (GRCm39) D20E probably benign Het
Or2ag19 A G 7: 106,444,403 (GRCm39) Y195C possibly damaging Het
Or52e8b A G 7: 104,673,767 (GRCm39) V140A probably benign Het
Or5b120 C T 19: 13,480,121 (GRCm39) T138M probably benign Het
Or6c69 A G 10: 129,747,550 (GRCm39) V199A probably benign Het
Otog A G 7: 45,933,332 (GRCm39) H1291R probably benign Het
Pgbd1 A G 13: 21,607,462 (GRCm39) L244P probably damaging Het
Ranbp2 A G 10: 58,299,808 (GRCm39) I481V probably benign Het
Rbp3 A T 14: 33,677,749 (GRCm39) I566F probably damaging Het
Rsph4a A G 10: 33,781,525 (GRCm39) D125G probably benign Het
Scn11a A G 9: 119,598,873 (GRCm39) V1219A probably damaging Het
Serpine3 G A 14: 62,911,830 (GRCm39) G264D probably benign Het
Slc4a10 T C 2: 62,087,806 (GRCm39) F400L probably damaging Het
Slco1a4 C T 6: 141,791,173 (GRCm39) V8I probably benign Het
Spen T C 4: 141,215,335 (GRCm39) D499G unknown Het
Tars1 A G 15: 11,388,261 (GRCm39) V485A probably benign Het
Tcerg1l A G 7: 137,963,496 (GRCm39) L258P probably damaging Het
Tmc2 A T 2: 130,089,880 (GRCm39) I622F probably damaging Het
Tmem183a A T 1: 134,282,444 (GRCm39) N220K probably damaging Het
Tnni3 T C 7: 4,523,525 (GRCm39) D146G probably damaging Het
Trappc11 G T 8: 47,954,715 (GRCm39) D908E probably damaging Het
Trappc8 A G 18: 20,996,608 (GRCm39) Y436H probably damaging Het
Ttc41 G A 10: 86,612,254 (GRCm39) V1176I probably benign Het
Ube2b A G 11: 51,888,699 (GRCm39) V24A probably benign Het
Usp30 T C 5: 114,251,022 (GRCm39) C233R probably damaging Het
Vmn1r87 T A 7: 12,865,703 (GRCm39) T195S possibly damaging Het
Vmn2r24 T C 6: 123,783,479 (GRCm39) probably benign Het
Vmn2r81 C A 10: 79,128,858 (GRCm39) T583N probably damaging Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Wdr1 C A 5: 38,687,315 (GRCm39) V239L probably benign Het
Wdr17 C T 8: 55,156,942 (GRCm39) probably benign Het
Zfhx4 A C 3: 5,306,789 (GRCm39) D5A probably damaging Het
Zfyve27 T C 19: 42,160,184 (GRCm39) probably null Het
Other mutations in Stk32c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Stk32c APN 7 138,768,069 (GRCm39) missense possibly damaging 0.47
IGL02559:Stk32c APN 7 138,700,606 (GRCm39) missense probably benign 0.00
IGL02805:Stk32c APN 7 138,701,762 (GRCm39) missense probably damaging 1.00
R0531:Stk32c UTSW 7 138,700,636 (GRCm39) missense probably damaging 0.97
R0622:Stk32c UTSW 7 138,768,026 (GRCm39) missense probably benign 0.00
R1140:Stk32c UTSW 7 138,705,095 (GRCm39) missense probably damaging 0.99
R1473:Stk32c UTSW 7 138,705,095 (GRCm39) missense probably damaging 0.99
R1697:Stk32c UTSW 7 138,701,740 (GRCm39) missense probably benign 0.25
R1855:Stk32c UTSW 7 138,701,363 (GRCm39) missense probably damaging 0.97
R4290:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R4293:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R4295:Stk32c UTSW 7 138,700,704 (GRCm39) critical splice acceptor site probably null
R5323:Stk32c UTSW 7 138,699,276 (GRCm39) missense probably benign 0.07
R5854:Stk32c UTSW 7 138,768,195 (GRCm39) intron probably benign
R5907:Stk32c UTSW 7 138,700,590 (GRCm39) missense probably benign 0.32
R6115:Stk32c UTSW 7 138,700,628 (GRCm39) nonsense probably null
R6117:Stk32c UTSW 7 138,702,839 (GRCm39) nonsense probably null
R6176:Stk32c UTSW 7 138,700,691 (GRCm39) missense probably benign 0.02
R6460:Stk32c UTSW 7 138,685,190 (GRCm39) missense probably damaging 1.00
R6695:Stk32c UTSW 7 138,702,880 (GRCm39) missense probably damaging 1.00
R6745:Stk32c UTSW 7 138,702,809 (GRCm39) missense probably damaging 0.99
R7177:Stk32c UTSW 7 138,684,218 (GRCm39) missense possibly damaging 0.62
R7676:Stk32c UTSW 7 138,685,220 (GRCm39) missense possibly damaging 0.87
R7721:Stk32c UTSW 7 138,768,069 (GRCm39) missense possibly damaging 0.47
R8977:Stk32c UTSW 7 138,705,161 (GRCm39) missense possibly damaging 0.69
R9004:Stk32c UTSW 7 138,702,859 (GRCm39) missense probably damaging 1.00
R9117:Stk32c UTSW 7 138,768,141 (GRCm39) missense unknown
R9481:Stk32c UTSW 7 138,768,173 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GTCACCAGAGCACTAATGTCCCTG -3'
(R):5'- TTTGTGCCCAATGTAAGCCCCG -3'

Sequencing Primer
(F):5'- AATGTCCCTGGGCATAGCATC -3'
(R):5'- AATGTAAGCCCCGAGTGC -3'
Posted On 2014-04-24