Mutagenetix > Incidental Mutation

Incidental Mutation 'R1589:Trappc11'

177729

Institutional Source

Beutler Lab

Gene Symbol

Trappc11

Ensembl Gene

ENSMUSG00000038102

Gene Name

trafficking protein particle complex 11

Synonyms

D030016E14Rik

MMRRC Submission

039626-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1589 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47490115-47533470 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 47501680 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 908 (D908E)

Ref Sequence

ENSEMBL: ENSMUSP00000047562 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039061] [ENSMUST00000120987]

AlphaFold

B2RXC1

Predicted Effect

probably damaging
Transcript: ENSMUST00000039061
AA Change: D908E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000047562
Gene: ENSMUSG00000038102
AA Change: D908E

Domain	Start	End	E-Value	Type
Pfam:Foie-gras_1	263	522	3e-78	PFAM
Pfam:Gryzun	978	1114	3.9e-10	PFAM
Pfam:Gryzun-like	1036	1095	2.4e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120987

SMART Domains

Protein: ENSMUSP00000113779
Gene: ENSMUSG00000038102

Domain	Start	End	E-Value	Type
Pfam:Gryzun	1	155	4e-25	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123958

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125065

Meta Mutation Damage Score

0.2421

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.8%
20x: 90.8%

Validation Efficiency

97% (89/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700008P02Rik	A	G	3: 6,620,441		probably benign	Het
Aadacl2	C	T	3: 60,010,576	T82I	probably benign	Het
Acadl	T	C	1: 66,853,223	N147S	probably benign	Het
Actr3	A	T	1: 125,408,563	M79K	probably damaging	Het
Agbl3	A	G	6: 34,857,517	S874G	possibly damaging	Het
Aoah	A	T	13: 21,002,948	T472S	probably damaging	Het
Asb16	A	T	11: 102,268,995	D58V	probably damaging	Het
B4galt1	T	C	4: 40,823,575	D172G	probably benign	Het
Bax	T	C	7: 45,465,247	N55S	possibly damaging	Het
Bdkrb2	A	G	12: 105,591,859	N120D	possibly damaging	Het
Bicdl1	T	C	5: 115,651,266		probably benign	Het
Cand1	A	G	10: 119,213,566	L425P	probably damaging	Het
Caskin1	G	A	17: 24,505,478		probably null	Het
Cd248	C	T	19: 5,069,932	P603S	probably benign	Het
Cep95	G	T	11: 106,800,104	R143L	probably benign	Het
Clptm1l	G	T	13: 73,614,673		probably null	Het
Cntnap5a	T	C	1: 116,060,200	F154L	possibly damaging	Het
Cyld	A	T	8: 88,709,990	I303F	possibly damaging	Het
Dock2	A	G	11: 34,706,461	S370P	probably damaging	Het
Enah	G	T	1: 181,922,293	T327K	probably damaging	Het
Farp2	A	T	1: 93,579,860	S427C	probably damaging	Het
Fbxw11	C	T	11: 32,733,612	T301M	probably damaging	Het
Foxc2	A	T	8: 121,117,176	T188S	probably benign	Het
Fzd2	A	G	11: 102,606,328	T533A	probably benign	Het
Glb1l2	G	T	9: 26,769,038	S248*	probably null	Het
Glul	A	T	1: 153,905,538		probably benign	Het
Gm28042	A	G	2: 120,041,406	T946A	probably benign	Het
Golga3	T	A	5: 110,181,783	D2E	probably damaging	Het
Grm1	A	T	10: 10,719,967	F639Y	probably benign	Het
Gzmn	A	G	14: 56,165,911	L247P	probably benign	Het
Hgf	T	G	5: 16,613,785	I525R	probably damaging	Het
Hnrnpul2	T	A	19: 8,831,332	D719E	probably benign	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Itga9	T	C	9: 118,607,117		probably null	Het
Itgb1	T	A	8: 128,705,458	C16S	probably damaging	Het
Itgb1	G	T	8: 128,705,459	C16F	possibly damaging	Het
Kat14	A	G	2: 144,394,100	I251V	probably benign	Het
Kdsr	A	T	1: 106,734,541		probably null	Het
Kif12	T	A	4: 63,166,500	E527V	probably benign	Het
Larp1b	T	C	3: 41,033,474	S44P	probably damaging	Het
Lonp2	T	C	8: 86,673,072		probably benign	Het
Lrp1	C	T	10: 127,605,606	S216N	probably benign	Het
Lrrc19	T	C	4: 94,640,950	S32G	probably benign	Het
Mdm2	G	A	10: 117,690,529	T335M	probably benign	Het
Mettl25	A	G	10: 105,779,632	Y504H	probably damaging	Het
Mill1	T	C	7: 18,245,647	I13T	probably benign	Het
Mmachc	T	A	4: 116,703,524	Q258L	probably benign	Het
Mpdz	T	A	4: 81,421,176	I5L	probably benign	Het
Mrps2	C	T	2: 28,469,488	A119V	probably benign	Het
Mtmr11	A	G	3: 96,168,113	T370A	probably benign	Het
Nmi	T	C	2: 51,958,977	I34V	possibly damaging	Het
Obscn	A	T	11: 59,036,075	M5538K	possibly damaging	Het
Ogdhl	T	C	14: 32,325,865	I24T	probably benign	Het
Olfr1477	C	T	19: 13,502,757	T138M	probably benign	Het
Olfr675	A	G	7: 105,024,560	V140A	probably benign	Het
Olfr703	A	G	7: 106,845,196	Y195C	possibly damaging	Het
Olfr816	A	G	10: 129,911,681	V199A	probably benign	Het
Omp	G	T	7: 98,145,359	D20E	probably benign	Het
Otog	A	G	7: 46,283,908	H1291R	probably benign	Het
Pgbd1	A	G	13: 21,423,292	L244P	probably damaging	Het
Ranbp2	A	G	10: 58,463,986	I481V	probably benign	Het
Rbp3	A	T	14: 33,955,792	I566F	probably damaging	Het
Rsph4a	A	G	10: 33,905,529	D125G	probably benign	Het
Scn11a	A	G	9: 119,769,807	V1219A	probably damaging	Het
Serpine3	G	A	14: 62,674,381	G264D	probably benign	Het
Slc4a10	T	C	2: 62,257,462	F400L	probably damaging	Het
Slco1a4	C	T	6: 141,845,447	V8I	probably benign	Het
Soga1	A	T	2: 157,027,637	M1026K	probably benign	Het
Spen	T	C	4: 141,488,024	D499G	unknown	Het
Stk32c	A	G	7: 139,119,015		probably null	Het
Tars	A	G	15: 11,388,175	V485A	probably benign	Het
Tcerg1l	A	G	7: 138,361,767	L258P	probably damaging	Het
Tmc2	A	T	2: 130,247,960	I622F	probably damaging	Het
Tmem183a	A	T	1: 134,354,706	N220K	probably damaging	Het
Tnni3	T	C	7: 4,520,526	D146G	probably damaging	Het
Trappc8	A	G	18: 20,863,551	Y436H	probably damaging	Het
Ttc41	G	A	10: 86,776,390	V1176I	probably benign	Het
Ube2b	A	G	11: 51,997,872	V24A	probably benign	Het
Usp30	T	C	5: 114,112,961	C233R	probably damaging	Het
Vmn1r87	T	A	7: 13,131,776	T195S	possibly damaging	Het
Vmn2r24	T	C	6: 123,806,520		probably benign	Het
Vmn2r81	C	A	10: 79,293,024	T583N	probably damaging	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Wdr1	C	A	5: 38,529,972	V239L	probably benign	Het
Wdr17	C	T	8: 54,703,907		probably benign	Het
Zfhx4	A	C	3: 5,241,729	D5A	probably damaging	Het
Zfyve27	T	C	19: 42,171,745		probably null	Het

Other mutations in Trappc11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Trappc11	APN	8	47503302	unclassified	probably benign
IGL01300:Trappc11	APN	8	47501868	missense	probably benign
IGL01312:Trappc11	APN	8	47505677	missense	possibly damaging	0.95
IGL01344:Trappc11	APN	8	47519704	missense	probably damaging	1.00
IGL01518:Trappc11	APN	8	47501869	splice site	probably null
IGL01747:Trappc11	APN	8	47519621	missense	probably benign	0.41
IGL01781:Trappc11	APN	8	47514128	missense	possibly damaging	0.95
IGL01908:Trappc11	APN	8	47503994	missense	probably damaging	1.00
IGL01956:Trappc11	APN	8	47528001	missense	possibly damaging	0.86
IGL02266:Trappc11	APN	8	47505731	missense	probably damaging	1.00
IGL02377:Trappc11	APN	8	47530650	critical splice donor site	probably null
IGL02530:Trappc11	APN	8	47507582	missense	probably damaging	1.00
IGL02676:Trappc11	APN	8	47493413	splice site	probably benign
IGL03030:Trappc11	APN	8	47513929	missense	probably damaging	0.98
IGL03393:Trappc11	APN	8	47510877	missense	possibly damaging	0.95
bantu	UTSW	8	47498666	missense	probably benign	0.44
bunyoro	UTSW	8	47512285	splice site	probably null
nyoro	UTSW	8	47526979	missense	possibly damaging	0.73
serval	UTSW	8	47503965	missense	probably damaging	1.00
R0009:Trappc11	UTSW	8	47503320	missense	possibly damaging	0.70
R0009:Trappc11	UTSW	8	47503320	missense	possibly damaging	0.70
R0043:Trappc11	UTSW	8	47505575	splice site	probably benign
R0180:Trappc11	UTSW	8	47527974	missense	possibly damaging	0.86
R0529:Trappc11	UTSW	8	47526979	missense	possibly damaging	0.73
R0538:Trappc11	UTSW	8	47503412	missense	probably benign	0.01
R0740:Trappc11	UTSW	8	47524588	missense	probably damaging	0.99
R1352:Trappc11	UTSW	8	47525046	missense	possibly damaging	0.90
R1469:Trappc11	UTSW	8	47503965	missense	probably damaging	1.00
R1469:Trappc11	UTSW	8	47503965	missense	probably damaging	1.00
R1502:Trappc11	UTSW	8	47530827	missense	possibly damaging	0.94
R1741:Trappc11	UTSW	8	47529327	critical splice donor site	probably null
R2292:Trappc11	UTSW	8	47505736	missense	probably damaging	1.00
R2303:Trappc11	UTSW	8	47503416	missense	probably damaging	0.99
R2931:Trappc11	UTSW	8	47503942	missense	probably damaging	0.99
R3522:Trappc11	UTSW	8	47498673	missense	possibly damaging	0.93
R3714:Trappc11	UTSW	8	47505316	intron	probably benign
R3739:Trappc11	UTSW	8	47514103	missense	probably damaging	0.98
R4165:Trappc11	UTSW	8	47524968	splice site	probably benign
R4581:Trappc11	UTSW	8	47493345	missense	probably damaging	0.97
R4598:Trappc11	UTSW	8	47513766	missense	probably damaging	0.98
R4939:Trappc11	UTSW	8	47519665	missense	probably damaging	1.00
R4990:Trappc11	UTSW	8	47490895	missense	probably benign	0.41
R4994:Trappc11	UTSW	8	47522441	nonsense	probably null
R5091:Trappc11	UTSW	8	47512604	missense	probably benign	0.00
R5123:Trappc11	UTSW	8	47513402	missense	probably damaging	0.99
R5176:Trappc11	UTSW	8	47510963	missense	possibly damaging	0.79
R5279:Trappc11	UTSW	8	47505304	intron	probably benign
R5293:Trappc11	UTSW	8	47493342	missense	possibly damaging	0.83
R5294:Trappc11	UTSW	8	47530731	missense	possibly damaging	0.88
R5661:Trappc11	UTSW	8	47512607	missense	probably damaging	0.99
R5838:Trappc11	UTSW	8	47512559	critical splice donor site	probably null
R5889:Trappc11	UTSW	8	47519578	missense	probably benign	0.40
R5952:Trappc11	UTSW	8	47496917	critical splice donor site	probably null
R5959:Trappc11	UTSW	8	47501558	missense	probably damaging	0.97
R6239:Trappc11	UTSW	8	47529494	missense	possibly damaging	0.73
R6322:Trappc11	UTSW	8	47530773	missense	possibly damaging	0.95
R6369:Trappc11	UTSW	8	47512285	splice site	probably null
R7541:Trappc11	UTSW	8	47505582	splice site	probably null
R7544:Trappc11	UTSW	8	47522414	missense	possibly damaging	0.73
R7762:Trappc11	UTSW	8	47522376	missense	probably damaging	0.99
R7964:Trappc11	UTSW	8	47526944	missense	possibly damaging	0.54
R8183:Trappc11	UTSW	8	47529356	missense	possibly damaging	0.93
R8282:Trappc11	UTSW	8	47516589	missense	probably damaging	0.97
R8733:Trappc11	UTSW	8	47501848	missense	probably damaging	1.00
R8782:Trappc11	UTSW	8	47498666	missense	probably benign	0.44
R8853:Trappc11	UTSW	8	47529404	missense	probably damaging	0.98
R9544:Trappc11	UTSW	8	47519678	missense	possibly damaging	0.94
R9709:Trappc11	UTSW	8	47493313	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGCACCGCTAACCGACACG -3'
(R):5'- TGCCTTATGCTTTCTTCCAGGATGATAC -3'

Sequencing Primer
(F):5'- GCAGTCATTGATGGAGCAAG -3'
(R):5'- CTTCCAGGATGATACTGTCACAATAG -3'

Posted On

2014-04-24