Incidental Mutation 'R1589:Wdr17'
ID177730
Institutional Source Beutler Lab
Gene Symbol Wdr17
Ensembl Gene ENSMUSG00000039375
Gene NameWD repeat domain 17
SynonymsB230207L18Rik, 3010002I12Rik
MMRRC Submission 039626-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1589 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location54629055-54887184 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 54703907 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127511] [ENSMUST00000129132] [ENSMUST00000144711] [ENSMUST00000148408] [ENSMUST00000150488] [ENSMUST00000175915] [ENSMUST00000176866]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126316
Predicted Effect probably benign
Transcript: ENSMUST00000127511
SMART Domains Protein: ENSMUSP00000115550
Gene: ENSMUSG00000039375

DomainStartEndE-ValueType
WD40 72 112 8.55e-8 SMART
WD40 162 202 1.58e2 SMART
WD40 205 252 4.26e1 SMART
WD40 255 298 1.15e0 SMART
WD40 383 422 1.59e-7 SMART
WD40 425 465 2.39e0 SMART
WD40 468 509 5.52e-2 SMART
WD40 511 550 4.14e-6 SMART
WD40 555 595 5.14e-11 SMART
WD40 598 638 6.58e-9 SMART
WD40 641 681 6.28e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129132
SMART Domains Protein: ENSMUSP00000134935
Gene: ENSMUSG00000039375

DomainStartEndE-ValueType
WD40 48 88 8.55e-8 SMART
Blast:WD40 91 131 1e-12 BLAST
WD40 138 178 1.58e2 SMART
WD40 181 228 4.26e1 SMART
WD40 231 271 9.86e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144711
SMART Domains Protein: ENSMUSP00000117710
Gene: ENSMUSG00000039375

DomainStartEndE-ValueType
WD40 72 112 8.55e-8 SMART
WD40 194 235 7.64e1 SMART
WD40 238 281 1.15e0 SMART
WD40 366 405 1.59e-7 SMART
WD40 408 448 2.39e0 SMART
WD40 451 492 5.52e-2 SMART
WD40 494 533 4.14e-6 SMART
WD40 538 578 5.14e-11 SMART
WD40 581 621 6.58e-9 SMART
WD40 624 664 6.28e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148806
Predicted Effect probably benign
Transcript: ENSMUST00000150488
SMART Domains Protein: ENSMUSP00000122326
Gene: ENSMUSG00000039375

DomainStartEndE-ValueType
WD40 48 88 8.55e-8 SMART
WD40 138 178 1.58e2 SMART
WD40 181 228 4.26e1 SMART
WD40 231 274 1.15e0 SMART
WD40 359 398 1.59e-7 SMART
WD40 401 441 2.39e0 SMART
WD40 444 485 5.52e-2 SMART
WD40 487 526 4.14e-6 SMART
WD40 531 571 5.14e-11 SMART
WD40 574 614 6.58e-9 SMART
WD40 617 657 6.28e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175915
SMART Domains Protein: ENSMUSP00000135805
Gene: ENSMUSG00000039375

DomainStartEndE-ValueType
WD40 48 88 8.55e-8 SMART
WD40 138 178 1.58e2 SMART
WD40 181 228 4.26e1 SMART
WD40 231 274 1.15e0 SMART
WD40 359 398 1.59e-7 SMART
WD40 401 441 2.39e0 SMART
WD40 444 485 5.52e-2 SMART
WD40 487 526 4.14e-6 SMART
WD40 531 571 5.14e-11 SMART
WD40 574 614 6.58e-9 SMART
WD40 617 657 6.28e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176866
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein. It is abundantly expressed in retina and testis, and is thought to be a candidate gene for retinal disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,441 probably benign Het
Aadacl2 C T 3: 60,010,576 T82I probably benign Het
Acadl T C 1: 66,853,223 N147S probably benign Het
Actr3 A T 1: 125,408,563 M79K probably damaging Het
Agbl3 A G 6: 34,857,517 S874G possibly damaging Het
Aoah A T 13: 21,002,948 T472S probably damaging Het
Asb16 A T 11: 102,268,995 D58V probably damaging Het
B4galt1 T C 4: 40,823,575 D172G probably benign Het
Bax T C 7: 45,465,247 N55S possibly damaging Het
Bdkrb2 A G 12: 105,591,859 N120D possibly damaging Het
Bicdl1 T C 5: 115,651,266 probably benign Het
Cand1 A G 10: 119,213,566 L425P probably damaging Het
Caskin1 G A 17: 24,505,478 probably null Het
Cd248 C T 19: 5,069,932 P603S probably benign Het
Cep95 G T 11: 106,800,104 R143L probably benign Het
Clptm1l G T 13: 73,614,673 probably null Het
Cntnap5a T C 1: 116,060,200 F154L possibly damaging Het
Cyld A T 8: 88,709,990 I303F possibly damaging Het
Dock2 A G 11: 34,706,461 S370P probably damaging Het
Enah G T 1: 181,922,293 T327K probably damaging Het
Farp2 A T 1: 93,579,860 S427C probably damaging Het
Fbxw11 C T 11: 32,733,612 T301M probably damaging Het
Foxc2 A T 8: 121,117,176 T188S probably benign Het
Fzd2 A G 11: 102,606,328 T533A probably benign Het
Glb1l2 G T 9: 26,769,038 S248* probably null Het
Glul A T 1: 153,905,538 probably benign Het
Gm28042 A G 2: 120,041,406 T946A probably benign Het
Golga3 T A 5: 110,181,783 D2E probably damaging Het
Grm1 A T 10: 10,719,967 F639Y probably benign Het
Gzmn A G 14: 56,165,911 L247P probably benign Het
Hgf T G 5: 16,613,785 I525R probably damaging Het
Hnrnpul2 T A 19: 8,831,332 D719E probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itga9 T C 9: 118,607,117 probably null Het
Itgb1 T A 8: 128,705,458 C16S probably damaging Het
Itgb1 G T 8: 128,705,459 C16F possibly damaging Het
Kat14 A G 2: 144,394,100 I251V probably benign Het
Kdsr A T 1: 106,734,541 probably null Het
Kif12 T A 4: 63,166,500 E527V probably benign Het
Larp1b T C 3: 41,033,474 S44P probably damaging Het
Lonp2 T C 8: 86,673,072 probably benign Het
Lrp1 C T 10: 127,605,606 S216N probably benign Het
Lrrc19 T C 4: 94,640,950 S32G probably benign Het
Mdm2 G A 10: 117,690,529 T335M probably benign Het
Mettl25 A G 10: 105,779,632 Y504H probably damaging Het
Mill1 T C 7: 18,245,647 I13T probably benign Het
Mmachc T A 4: 116,703,524 Q258L probably benign Het
Mpdz T A 4: 81,421,176 I5L probably benign Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Mtmr11 A G 3: 96,168,113 T370A probably benign Het
Nmi T C 2: 51,958,977 I34V possibly damaging Het
Obscn A T 11: 59,036,075 M5538K possibly damaging Het
Ogdhl T C 14: 32,325,865 I24T probably benign Het
Olfr1477 C T 19: 13,502,757 T138M probably benign Het
Olfr675 A G 7: 105,024,560 V140A probably benign Het
Olfr703 A G 7: 106,845,196 Y195C possibly damaging Het
Olfr816 A G 10: 129,911,681 V199A probably benign Het
Omp G T 7: 98,145,359 D20E probably benign Het
Otog A G 7: 46,283,908 H1291R probably benign Het
Pgbd1 A G 13: 21,423,292 L244P probably damaging Het
Ranbp2 A G 10: 58,463,986 I481V probably benign Het
Rbp3 A T 14: 33,955,792 I566F probably damaging Het
Rsph4a A G 10: 33,905,529 D125G probably benign Het
Scn11a A G 9: 119,769,807 V1219A probably damaging Het
Serpine3 G A 14: 62,674,381 G264D probably benign Het
Slc4a10 T C 2: 62,257,462 F400L probably damaging Het
Slco1a4 C T 6: 141,845,447 V8I probably benign Het
Soga1 A T 2: 157,027,637 M1026K probably benign Het
Spen T C 4: 141,488,024 D499G unknown Het
Stk32c A G 7: 139,119,015 probably null Het
Tars A G 15: 11,388,175 V485A probably benign Het
Tcerg1l A G 7: 138,361,767 L258P probably damaging Het
Tmc2 A T 2: 130,247,960 I622F probably damaging Het
Tmem183a A T 1: 134,354,706 N220K probably damaging Het
Tnni3 T C 7: 4,520,526 D146G probably damaging Het
Trappc11 G T 8: 47,501,680 D908E probably damaging Het
Trappc8 A G 18: 20,863,551 Y436H probably damaging Het
Ttc41 G A 10: 86,776,390 V1176I probably benign Het
Ube2b A G 11: 51,997,872 V24A probably benign Het
Usp30 T C 5: 114,112,961 C233R probably damaging Het
Vmn1r87 T A 7: 13,131,776 T195S possibly damaging Het
Vmn2r24 T C 6: 123,806,520 probably benign Het
Vmn2r81 C A 10: 79,293,024 T583N probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr1 C A 5: 38,529,972 V239L probably benign Het
Zfhx4 A C 3: 5,241,729 D5A probably damaging Het
Zfyve27 T C 19: 42,171,745 probably null Het
Other mutations in Wdr17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Wdr17 APN 8 54687711 missense probably damaging 1.00
IGL00496:Wdr17 APN 8 54659579 splice site probably benign
IGL01318:Wdr17 APN 8 54672550 missense probably damaging 1.00
IGL01347:Wdr17 APN 8 54651345 missense probably benign
IGL01654:Wdr17 APN 8 54662879 missense probably damaging 1.00
IGL02010:Wdr17 APN 8 54659703 missense probably damaging 0.97
IGL02085:Wdr17 APN 8 54687736 nonsense probably null
IGL02205:Wdr17 APN 8 54696300 missense probably damaging 1.00
IGL02375:Wdr17 APN 8 54696388 missense possibly damaging 0.94
IGL02705:Wdr17 APN 8 54648215 splice site probably null
IGL02719:Wdr17 APN 8 54693054 splice site probably null
IGL03051:Wdr17 APN 8 54651314 missense probably damaging 0.99
IGL03131:Wdr17 APN 8 54696267 critical splice donor site probably null
IGL03172:Wdr17 APN 8 54661480 missense probably damaging 0.96
enthralled UTSW 8 54659681 missense possibly damaging 0.85
riveted UTSW 8 54632487 missense probably benign 0.00
thrilled UTSW 8 54696268 critical splice donor site probably null
IGL03138:Wdr17 UTSW 8 54649143 missense probably damaging 1.00
PIT4458001:Wdr17 UTSW 8 54673579 nonsense probably null
R0011:Wdr17 UTSW 8 54672501 missense possibly damaging 0.87
R0011:Wdr17 UTSW 8 54672501 missense possibly damaging 0.87
R0124:Wdr17 UTSW 8 54635491 missense probably damaging 1.00
R0226:Wdr17 UTSW 8 54663008 missense probably benign 0.08
R0270:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0271:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0288:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0321:Wdr17 UTSW 8 54696268 critical splice donor site probably null
R0464:Wdr17 UTSW 8 54670392 splice site probably benign
R0479:Wdr17 UTSW 8 54651421 splice site probably null
R0488:Wdr17 UTSW 8 54693052 unclassified probably benign
R0552:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0553:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0600:Wdr17 UTSW 8 54661495 missense probably damaging 1.00
R0621:Wdr17 UTSW 8 54643191 missense probably benign 0.18
R0655:Wdr17 UTSW 8 54649198 missense probably damaging 1.00
R0730:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0789:Wdr17 UTSW 8 54659572 splice site probably benign
R0854:Wdr17 UTSW 8 54703881 missense probably benign
R0879:Wdr17 UTSW 8 54661481 missense probably benign 0.08
R1462:Wdr17 UTSW 8 54670328 missense probably damaging 1.00
R1462:Wdr17 UTSW 8 54670328 missense probably damaging 1.00
R1497:Wdr17 UTSW 8 54672501 missense possibly damaging 0.87
R1618:Wdr17 UTSW 8 54639895 missense probably damaging 1.00
R1768:Wdr17 UTSW 8 54673654 missense possibly damaging 0.84
R1778:Wdr17 UTSW 8 54690214 missense probably damaging 1.00
R1819:Wdr17 UTSW 8 54690124 missense probably benign 0.18
R1913:Wdr17 UTSW 8 54687726 missense probably damaging 1.00
R2129:Wdr17 UTSW 8 54632381 missense probably damaging 1.00
R2132:Wdr17 UTSW 8 54672506 missense probably damaging 1.00
R2309:Wdr17 UTSW 8 54643248 missense probably benign
R3882:Wdr17 UTSW 8 54639501 missense possibly damaging 0.53
R4097:Wdr17 UTSW 8 54635469 missense probably damaging 1.00
R4372:Wdr17 UTSW 8 54639895 missense probably damaging 1.00
R4380:Wdr17 UTSW 8 54648407 intron probably benign
R4480:Wdr17 UTSW 8 54664964 critical splice donor site probably null
R4654:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R4656:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R4669:Wdr17 UTSW 8 54690048 missense possibly damaging 0.72
R4719:Wdr17 UTSW 8 54639876 missense probably benign 0.33
R4912:Wdr17 UTSW 8 54629861 missense probably damaging 1.00
R5000:Wdr17 UTSW 8 54665126 missense possibly damaging 0.82
R5073:Wdr17 UTSW 8 54690236 critical splice acceptor site probably null
R5176:Wdr17 UTSW 8 54653878 critical splice donor site probably null
R5194:Wdr17 UTSW 8 54687604 missense probably damaging 1.00
R5270:Wdr17 UTSW 8 54643186 missense probably benign 0.20
R5300:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5325:Wdr17 UTSW 8 54659681 missense possibly damaging 0.85
R5336:Wdr17 UTSW 8 54632318 missense probably damaging 1.00
R5394:Wdr17 UTSW 8 54639489 missense possibly damaging 0.73
R5424:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5425:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5426:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5548:Wdr17 UTSW 8 54703851 missense probably damaging 0.97
R5681:Wdr17 UTSW 8 54662869 missense probably damaging 1.00
R5722:Wdr17 UTSW 8 54660771 critical splice donor site probably null
R5894:Wdr17 UTSW 8 54696300 missense probably damaging 1.00
R5906:Wdr17 UTSW 8 54639468 missense probably benign 0.33
R6038:Wdr17 UTSW 8 54632311 critical splice donor site probably null
R6038:Wdr17 UTSW 8 54632311 critical splice donor site probably null
R6391:Wdr17 UTSW 8 54661460 missense probably benign 0.04
R6605:Wdr17 UTSW 8 54681524 missense probably benign 0.16
R6892:Wdr17 UTSW 8 54673596 missense probably damaging 1.00
R7019:Wdr17 UTSW 8 54681453 missense probably damaging 1.00
R7257:Wdr17 UTSW 8 54632487 missense probably benign 0.00
R7481:Wdr17 UTSW 8 54661336 missense probably benign
R7868:Wdr17 UTSW 8 54696267 critical splice donor site probably null
R7939:Wdr17 UTSW 8 54687642 missense probably damaging 0.98
R7962:Wdr17 UTSW 8 54660771 critical splice donor site probably null
R8017:Wdr17 UTSW 8 54638368 missense possibly damaging 0.73
R8122:Wdr17 UTSW 8 54664976 missense probably damaging 1.00
R8226:Wdr17 UTSW 8 54693120 missense possibly damaging 0.52
R8251:Wdr17 UTSW 8 54657232 missense probably damaging 1.00
R8413:Wdr17 UTSW 8 54662918 missense probably benign 0.08
R8534:Wdr17 UTSW 8 54648230 missense probably benign 0.08
V5088:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
V5622:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
V5622:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
X0022:Wdr17 UTSW 8 54639494 missense probably benign 0.04
X0066:Wdr17 UTSW 8 54673560 missense probably damaging 1.00
Z1177:Wdr17 UTSW 8 54643185 missense probably benign 0.03
Z1177:Wdr17 UTSW 8 54670379 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTAGAACTCATCTAGCGTGCAG -3'
(R):5'- TGGGCAACACAAAATGAACTCCCTG -3'

Sequencing Primer
(F):5'- TAGGGTTCACTCACAACTGAAAAAG -3'
(R):5'- tgtttttgtttgtttgtttggtttg -3'
Posted On2014-04-24