Incidental Mutation 'R1589:Cyld'
ID 177732
Institutional Source Beutler Lab
Gene Symbol Cyld
Ensembl Gene ENSMUSG00000036712
Gene Name CYLD lysine 63 deubiquitinase
Synonyms CYLD1, C130039D01Rik, 2900009M21Rik, 2010013M14Rik
MMRRC Submission 039626-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1589 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 89423656-89478573 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89436618 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 303 (I303F)
Ref Sequence ENSEMBL: ENSMUSP00000147904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043526] [ENSMUST00000098519] [ENSMUST00000109626] [ENSMUST00000209206] [ENSMUST00000209532] [ENSMUST00000209559] [ENSMUST00000211554]
AlphaFold Q80TQ2
Predicted Effect probably benign
Transcript: ENSMUST00000043526
AA Change: I303F

PolyPhen 2 Score 0.340 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039834
Gene: ENSMUSG00000036712
AA Change: I303F

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
low complexity region 397 411 N/A INTRINSIC
CAP_GLY 471 539 2.68e-20 SMART
Pfam:UCH 591 891 1.7e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098519
AA Change: I303F

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096119
Gene: ENSMUSG00000036712
AA Change: I303F

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
Pfam:CYLD_phos_site 307 470 6.5e-88 PFAM
CAP_GLY 471 539 2.68e-20 SMART
Pfam:UCH 590 893 2.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109626
AA Change: I303F

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105254
Gene: ENSMUSG00000036712
AA Change: I303F

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
Pfam:CYLD_phos_site 304 467 2.5e-88 PFAM
CAP_GLY 468 536 2.68e-20 SMART
Pfam:UCH 587 890 2e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209206
AA Change: I303F

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000209532
AA Change: I303F

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000209559
AA Change: I303F

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209742
Predicted Effect probably benign
Transcript: ENSMUST00000211554
AA Change: I303F

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
Meta Mutation Damage Score 0.1194 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the ubiquitin C-terminal hydrolase subfamily of the deubiquitinating enzyme family. Members of this family catalyze the removal of ubiquitin from a substrate or another ubiquitin molecule and thereby play important roles in regulating signaling pathways, recycling ubiquitin and regulating protein stability. This protein removes ubiquitin from K-63-linked ubiquitin chains from proteins involved in NF-kappaB signaling and thus acts as a negative regulator of this pathway. In humans mutations in this gene have been associated with cylindromatosis, an autosomal dominant predisposition to tumors of skin appendages. In mouse deficiency of this gene impairs thymocyte development and increases susceptibility to skin and colon tumors. A pseudogene of this gene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Various knockout models with different exon deletions have been created. Observed phenotypes include altered T cell and B cell development, susceptibility to induced skin tumors, resistance to lethal lung infection, high colon tumor incidence, kinky tails, and neonatal death due to lung dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,685,501 (GRCm39) probably benign Het
Aadacl2 C T 3: 59,917,997 (GRCm39) T82I probably benign Het
Acadl T C 1: 66,892,382 (GRCm39) N147S probably benign Het
Actr3 A T 1: 125,336,300 (GRCm39) M79K probably damaging Het
Agbl3 A G 6: 34,834,452 (GRCm39) S874G possibly damaging Het
Aoah A T 13: 21,187,118 (GRCm39) T472S probably damaging Het
Asb16 A T 11: 102,159,821 (GRCm39) D58V probably damaging Het
B4galt1 T C 4: 40,823,575 (GRCm39) D172G probably benign Het
Bax T C 7: 45,114,671 (GRCm39) N55S possibly damaging Het
Bdkrb2 A G 12: 105,558,118 (GRCm39) N120D possibly damaging Het
Bicdl1 T C 5: 115,789,325 (GRCm39) probably benign Het
Cand1 A G 10: 119,049,471 (GRCm39) L425P probably damaging Het
Caskin1 G A 17: 24,724,452 (GRCm39) probably null Het
Cd248 C T 19: 5,119,960 (GRCm39) P603S probably benign Het
Cep95 G T 11: 106,690,930 (GRCm39) R143L probably benign Het
Clptm1l G T 13: 73,762,792 (GRCm39) probably null Het
Cntnap5a T C 1: 115,987,930 (GRCm39) F154L possibly damaging Het
Dock2 A G 11: 34,597,288 (GRCm39) S370P probably damaging Het
Enah G T 1: 181,749,858 (GRCm39) T327K probably damaging Het
Farp2 A T 1: 93,507,582 (GRCm39) S427C probably damaging Het
Fbxw11 C T 11: 32,683,612 (GRCm39) T301M probably damaging Het
Foxc2 A T 8: 121,843,915 (GRCm39) T188S probably benign Het
Fzd2 A G 11: 102,497,154 (GRCm39) T533A probably benign Het
Glb1l2 G T 9: 26,680,334 (GRCm39) S248* probably null Het
Glul A T 1: 153,781,284 (GRCm39) probably benign Het
Gm28042 A G 2: 119,871,887 (GRCm39) T946A probably benign Het
Golga3 T A 5: 110,329,649 (GRCm39) D2E probably damaging Het
Grm1 A T 10: 10,595,711 (GRCm39) F639Y probably benign Het
Gzmn A G 14: 56,403,368 (GRCm39) L247P probably benign Het
Hgf T G 5: 16,818,783 (GRCm39) I525R probably damaging Het
Hnrnpul2 T A 19: 8,808,696 (GRCm39) D719E probably benign Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Itga9 T C 9: 118,436,185 (GRCm39) probably null Het
Itgb1 T A 8: 129,431,939 (GRCm39) C16S probably damaging Het
Itgb1 G T 8: 129,431,940 (GRCm39) C16F possibly damaging Het
Kat14 A G 2: 144,236,020 (GRCm39) I251V probably benign Het
Kdsr A T 1: 106,662,271 (GRCm39) probably null Het
Kif12 T A 4: 63,084,737 (GRCm39) E527V probably benign Het
Larp1b T C 3: 40,987,909 (GRCm39) S44P probably damaging Het
Lonp2 T C 8: 87,399,700 (GRCm39) probably benign Het
Lrp1 C T 10: 127,441,475 (GRCm39) S216N probably benign Het
Lrrc19 T C 4: 94,529,187 (GRCm39) S32G probably benign Het
Mdm2 G A 10: 117,526,434 (GRCm39) T335M probably benign Het
Mettl25 A G 10: 105,615,493 (GRCm39) Y504H probably damaging Het
Mill1 T C 7: 17,979,572 (GRCm39) I13T probably benign Het
Mmachc T A 4: 116,560,721 (GRCm39) Q258L probably benign Het
Mpdz T A 4: 81,339,413 (GRCm39) I5L probably benign Het
Mrps2 C T 2: 28,359,500 (GRCm39) A119V probably benign Het
Mtcl2 A T 2: 156,869,557 (GRCm39) M1026K probably benign Het
Mtmr11 A G 3: 96,075,429 (GRCm39) T370A probably benign Het
Nmi T C 2: 51,848,989 (GRCm39) I34V possibly damaging Het
Obscn A T 11: 58,926,901 (GRCm39) M5538K possibly damaging Het
Ogdhl T C 14: 32,047,822 (GRCm39) I24T probably benign Het
Omp G T 7: 97,794,566 (GRCm39) D20E probably benign Het
Or2ag19 A G 7: 106,444,403 (GRCm39) Y195C possibly damaging Het
Or52e8b A G 7: 104,673,767 (GRCm39) V140A probably benign Het
Or5b120 C T 19: 13,480,121 (GRCm39) T138M probably benign Het
Or6c69 A G 10: 129,747,550 (GRCm39) V199A probably benign Het
Otog A G 7: 45,933,332 (GRCm39) H1291R probably benign Het
Pgbd1 A G 13: 21,607,462 (GRCm39) L244P probably damaging Het
Ranbp2 A G 10: 58,299,808 (GRCm39) I481V probably benign Het
Rbp3 A T 14: 33,677,749 (GRCm39) I566F probably damaging Het
Rsph4a A G 10: 33,781,525 (GRCm39) D125G probably benign Het
Scn11a A G 9: 119,598,873 (GRCm39) V1219A probably damaging Het
Serpine3 G A 14: 62,911,830 (GRCm39) G264D probably benign Het
Slc4a10 T C 2: 62,087,806 (GRCm39) F400L probably damaging Het
Slco1a4 C T 6: 141,791,173 (GRCm39) V8I probably benign Het
Spen T C 4: 141,215,335 (GRCm39) D499G unknown Het
Stk32c A G 7: 138,698,931 (GRCm39) probably null Het
Tars1 A G 15: 11,388,261 (GRCm39) V485A probably benign Het
Tcerg1l A G 7: 137,963,496 (GRCm39) L258P probably damaging Het
Tmc2 A T 2: 130,089,880 (GRCm39) I622F probably damaging Het
Tmem183a A T 1: 134,282,444 (GRCm39) N220K probably damaging Het
Tnni3 T C 7: 4,523,525 (GRCm39) D146G probably damaging Het
Trappc11 G T 8: 47,954,715 (GRCm39) D908E probably damaging Het
Trappc8 A G 18: 20,996,608 (GRCm39) Y436H probably damaging Het
Ttc41 G A 10: 86,612,254 (GRCm39) V1176I probably benign Het
Ube2b A G 11: 51,888,699 (GRCm39) V24A probably benign Het
Usp30 T C 5: 114,251,022 (GRCm39) C233R probably damaging Het
Vmn1r87 T A 7: 12,865,703 (GRCm39) T195S possibly damaging Het
Vmn2r24 T C 6: 123,783,479 (GRCm39) probably benign Het
Vmn2r81 C A 10: 79,128,858 (GRCm39) T583N probably damaging Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Wdr1 C A 5: 38,687,315 (GRCm39) V239L probably benign Het
Wdr17 C T 8: 55,156,942 (GRCm39) probably benign Het
Zfhx4 A C 3: 5,306,789 (GRCm39) D5A probably damaging Het
Zfyve27 T C 19: 42,160,184 (GRCm39) probably null Het
Other mutations in Cyld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Cyld APN 8 89,432,085 (GRCm39) missense probably benign 0.41
IGL00481:Cyld APN 8 89,433,918 (GRCm39) missense probably damaging 1.00
IGL01013:Cyld APN 8 89,468,990 (GRCm39) missense probably damaging 1.00
IGL01653:Cyld APN 8 89,467,998 (GRCm39) missense probably damaging 1.00
IGL01700:Cyld APN 8 89,433,727 (GRCm39) missense probably damaging 0.99
IGL01845:Cyld APN 8 89,432,403 (GRCm39) nonsense probably null
IGL02366:Cyld APN 8 89,456,381 (GRCm39) missense probably damaging 1.00
IGL02379:Cyld APN 8 89,471,556 (GRCm39) nonsense probably null
IGL02506:Cyld APN 8 89,456,218 (GRCm39) missense possibly damaging 0.86
IGL02563:Cyld APN 8 89,462,522 (GRCm39) missense probably damaging 1.00
IGL02565:Cyld APN 8 89,467,919 (GRCm39) missense probably damaging 1.00
IGL02814:Cyld APN 8 89,471,525 (GRCm39) missense probably benign 0.29
PIT4131001:Cyld UTSW 8 89,473,543 (GRCm39) missense probably damaging 0.98
R0101:Cyld UTSW 8 89,444,928 (GRCm39) critical splice donor site probably null
R0122:Cyld UTSW 8 89,468,920 (GRCm39) missense probably damaging 1.00
R0529:Cyld UTSW 8 89,456,387 (GRCm39) missense probably benign 0.34
R0838:Cyld UTSW 8 89,467,978 (GRCm39) missense probably benign 0.15
R1732:Cyld UTSW 8 89,458,295 (GRCm39) splice site probably benign
R2029:Cyld UTSW 8 89,471,940 (GRCm39) missense probably benign 0.09
R3701:Cyld UTSW 8 89,456,179 (GRCm39) missense probably benign
R3798:Cyld UTSW 8 89,461,558 (GRCm39) missense probably damaging 1.00
R4243:Cyld UTSW 8 89,457,383 (GRCm39) nonsense probably null
R4244:Cyld UTSW 8 89,457,383 (GRCm39) nonsense probably null
R4260:Cyld UTSW 8 89,468,019 (GRCm39) missense probably damaging 1.00
R4458:Cyld UTSW 8 89,445,929 (GRCm39) missense probably benign 0.24
R4551:Cyld UTSW 8 89,433,762 (GRCm39) missense possibly damaging 0.95
R4718:Cyld UTSW 8 89,468,933 (GRCm39) missense probably damaging 0.99
R4735:Cyld UTSW 8 89,456,278 (GRCm39) missense probably damaging 1.00
R4753:Cyld UTSW 8 89,471,444 (GRCm39) splice site probably null
R4966:Cyld UTSW 8 89,468,929 (GRCm39) missense possibly damaging 0.55
R4975:Cyld UTSW 8 89,433,860 (GRCm39) missense probably benign
R5375:Cyld UTSW 8 89,459,664 (GRCm39) missense possibly damaging 0.77
R5647:Cyld UTSW 8 89,461,554 (GRCm39) missense probably benign 0.10
R5741:Cyld UTSW 8 89,471,474 (GRCm39) missense probably damaging 1.00
R5837:Cyld UTSW 8 89,468,032 (GRCm39) missense probably damaging 0.99
R5931:Cyld UTSW 8 89,456,470 (GRCm39) splice site probably null
R5970:Cyld UTSW 8 89,459,621 (GRCm39) missense probably damaging 0.99
R5992:Cyld UTSW 8 89,459,681 (GRCm39) missense probably damaging 1.00
R6165:Cyld UTSW 8 89,473,561 (GRCm39) missense possibly damaging 0.88
R7135:Cyld UTSW 8 89,471,520 (GRCm39) missense possibly damaging 0.93
R7667:Cyld UTSW 8 89,468,930 (GRCm39) missense probably benign 0.01
R7858:Cyld UTSW 8 89,436,616 (GRCm39) missense probably damaging 0.98
R7912:Cyld UTSW 8 89,461,525 (GRCm39) missense probably damaging 1.00
R8076:Cyld UTSW 8 89,456,346 (GRCm39) missense probably benign 0.00
R8276:Cyld UTSW 8 89,461,556 (GRCm39) missense probably benign 0.06
R8282:Cyld UTSW 8 89,432,043 (GRCm39) missense probably benign 0.06
R8348:Cyld UTSW 8 89,456,197 (GRCm39) missense probably damaging 1.00
R8448:Cyld UTSW 8 89,456,197 (GRCm39) missense probably damaging 1.00
R8540:Cyld UTSW 8 89,473,568 (GRCm39) missense probably damaging 1.00
R8676:Cyld UTSW 8 89,456,138 (GRCm39) missense probably benign 0.02
R8710:Cyld UTSW 8 89,436,523 (GRCm39) missense probably damaging 1.00
R8957:Cyld UTSW 8 89,432,410 (GRCm39) missense probably damaging 0.97
R9329:Cyld UTSW 8 89,457,348 (GRCm39) missense probably benign 0.22
RF016:Cyld UTSW 8 89,432,069 (GRCm39) nonsense probably null
X0010:Cyld UTSW 8 89,473,540 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTAGCAGAGCACTCATCCATGTAAAGAA -3'
(R):5'- TGCTCCAACAGGCAGCAGTTT -3'

Sequencing Primer
(F):5'- CAGTAATTCAGATGAGCAAAGTGTCC -3'
(R):5'- TGAACCTTCCAATTATAAGAAAGGGG -3'
Posted On 2014-04-24