Incidental Mutation 'R1589:Scn11a'
ID177738
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Namesodium channel, voltage-gated, type XI, alpha
SynonymsNaN, NSS2, NaT, SNS2
MMRRC Submission 039626-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R1589 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119753759-119825456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119769807 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1219 (V1219A)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: V1219A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: V1219A

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: V1219A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8168 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,441 probably benign Het
Aadacl2 C T 3: 60,010,576 T82I probably benign Het
Acadl T C 1: 66,853,223 N147S probably benign Het
Actr3 A T 1: 125,408,563 M79K probably damaging Het
Agbl3 A G 6: 34,857,517 S874G possibly damaging Het
Aoah A T 13: 21,002,948 T472S probably damaging Het
Asb16 A T 11: 102,268,995 D58V probably damaging Het
B4galt1 T C 4: 40,823,575 D172G probably benign Het
Bax T C 7: 45,465,247 N55S possibly damaging Het
Bdkrb2 A G 12: 105,591,859 N120D possibly damaging Het
Bicdl1 T C 5: 115,651,266 probably benign Het
Cand1 A G 10: 119,213,566 L425P probably damaging Het
Caskin1 G A 17: 24,505,478 probably null Het
Cd248 C T 19: 5,069,932 P603S probably benign Het
Cep95 G T 11: 106,800,104 R143L probably benign Het
Clptm1l G T 13: 73,614,673 probably null Het
Cntnap5a T C 1: 116,060,200 F154L possibly damaging Het
Cyld A T 8: 88,709,990 I303F possibly damaging Het
Dock2 A G 11: 34,706,461 S370P probably damaging Het
Enah G T 1: 181,922,293 T327K probably damaging Het
Farp2 A T 1: 93,579,860 S427C probably damaging Het
Fbxw11 C T 11: 32,733,612 T301M probably damaging Het
Foxc2 A T 8: 121,117,176 T188S probably benign Het
Fzd2 A G 11: 102,606,328 T533A probably benign Het
Glb1l2 G T 9: 26,769,038 S248* probably null Het
Glul A T 1: 153,905,538 probably benign Het
Gm28042 A G 2: 120,041,406 T946A probably benign Het
Golga3 T A 5: 110,181,783 D2E probably damaging Het
Grm1 A T 10: 10,719,967 F639Y probably benign Het
Gzmn A G 14: 56,165,911 L247P probably benign Het
Hgf T G 5: 16,613,785 I525R probably damaging Het
Hnrnpul2 T A 19: 8,831,332 D719E probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itga9 T C 9: 118,607,117 probably null Het
Itgb1 T A 8: 128,705,458 C16S probably damaging Het
Itgb1 G T 8: 128,705,459 C16F possibly damaging Het
Kat14 A G 2: 144,394,100 I251V probably benign Het
Kdsr A T 1: 106,734,541 probably null Het
Kif12 T A 4: 63,166,500 E527V probably benign Het
Larp1b T C 3: 41,033,474 S44P probably damaging Het
Lonp2 T C 8: 86,673,072 probably benign Het
Lrp1 C T 10: 127,605,606 S216N probably benign Het
Lrrc19 T C 4: 94,640,950 S32G probably benign Het
Mdm2 G A 10: 117,690,529 T335M probably benign Het
Mettl25 A G 10: 105,779,632 Y504H probably damaging Het
Mill1 T C 7: 18,245,647 I13T probably benign Het
Mmachc T A 4: 116,703,524 Q258L probably benign Het
Mpdz T A 4: 81,421,176 I5L probably benign Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Mtmr11 A G 3: 96,168,113 T370A probably benign Het
Nmi T C 2: 51,958,977 I34V possibly damaging Het
Obscn A T 11: 59,036,075 M5538K possibly damaging Het
Ogdhl T C 14: 32,325,865 I24T probably benign Het
Olfr1477 C T 19: 13,502,757 T138M probably benign Het
Olfr675 A G 7: 105,024,560 V140A probably benign Het
Olfr703 A G 7: 106,845,196 Y195C possibly damaging Het
Olfr816 A G 10: 129,911,681 V199A probably benign Het
Omp G T 7: 98,145,359 D20E probably benign Het
Otog A G 7: 46,283,908 H1291R probably benign Het
Pgbd1 A G 13: 21,423,292 L244P probably damaging Het
Ranbp2 A G 10: 58,463,986 I481V probably benign Het
Rbp3 A T 14: 33,955,792 I566F probably damaging Het
Rsph4a A G 10: 33,905,529 D125G probably benign Het
Serpine3 G A 14: 62,674,381 G264D probably benign Het
Slc4a10 T C 2: 62,257,462 F400L probably damaging Het
Slco1a4 C T 6: 141,845,447 V8I probably benign Het
Soga1 A T 2: 157,027,637 M1026K probably benign Het
Spen T C 4: 141,488,024 D499G unknown Het
Stk32c A G 7: 139,119,015 probably null Het
Tars A G 15: 11,388,175 V485A probably benign Het
Tcerg1l A G 7: 138,361,767 L258P probably damaging Het
Tmc2 A T 2: 130,247,960 I622F probably damaging Het
Tmem183a A T 1: 134,354,706 N220K probably damaging Het
Tnni3 T C 7: 4,520,526 D146G probably damaging Het
Trappc11 G T 8: 47,501,680 D908E probably damaging Het
Trappc8 A G 18: 20,863,551 Y436H probably damaging Het
Ttc41 G A 10: 86,776,390 V1176I probably benign Het
Ube2b A G 11: 51,997,872 V24A probably benign Het
Usp30 T C 5: 114,112,961 C233R probably damaging Het
Vmn1r87 T A 7: 13,131,776 T195S possibly damaging Het
Vmn2r24 T C 6: 123,806,520 probably benign Het
Vmn2r81 C A 10: 79,293,024 T583N probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr1 C A 5: 38,529,972 V239L probably benign Het
Wdr17 C T 8: 54,703,907 probably benign Het
Zfhx4 A C 3: 5,241,729 D5A probably damaging Het
Zfyve27 T C 19: 42,171,745 probably null Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCACCCTGTAGACAGGACTAGGA -3'
(R):5'- GATGGAGAATGTGCCCTGTGCC -3'

Sequencing Primer
(F):5'- GATCCAACCTCTCCCTTTGTGG -3'
(R):5'- CCCAAGGTTGTTGTCAATGC -3'
Posted On2014-04-24