Mutagenetix > Incidental Mutation

Incidental Mutation 'R1589:Lrp1'

177748

Institutional Source

Beutler Lab

Gene Symbol

Lrp1

Ensembl Gene

ENSMUSG00000040249

Gene Name

low density lipoprotein receptor-related protein 1

Synonyms

A2mr, b2b1554Clo, CD91

MMRRC Submission

039626-MU

Accession Numbers

NCBI RefSeq: NM_008512.2; MGI:96828

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1589 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127538161-127621148 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 127605606 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 216 (S216N)

Ref Sequence

ENSEMBL: ENSMUSP00000044004 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049149] [ENSMUST00000118455] [ENSMUST00000121829]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000049149
AA Change: S216N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000044004
Gene: ENSMUSG00000040249
AA Change: S216N

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
LDLa	27	67	1.03e-15	SMART
LDLa	72	111	1.04e-11	SMART
EGF	115	150	8.78e-2	SMART
EGF_CA	151	190	4.49e-8	SMART
low complexity region	222	232	N/A	INTRINSIC
LY	273	315	7.07e-6	SMART
LY	316	359	2.31e-10	SMART
LY	360	402	8.3e-12	SMART
EGF	478	521	9.93e-1	SMART
LY	552	594	8.84e-7	SMART
LY	595	638	6.54e-10	SMART
LY	641	690	2.5e-15	SMART
LY	691	734	1.06e-9	SMART
EGF	807	844	1.38e1	SMART
LDLa	854	893	3.39e-16	SMART
LDLa	895	934	1.73e-13	SMART
LDLa	936	974	4.47e-16	SMART
LDLa	976	1014	2.53e-15	SMART
LDLa	1015	1054	2.95e-16	SMART
LDLa	1062	1100	3.24e-13	SMART
LDLa	1104	1143	2.97e-12	SMART
LDLa	1145	1185	1.24e-9	SMART
EGF	1185	1223	4.97e-1	SMART
EGF	1227	1263	6.02e0	SMART
LY	1290	1332	3.76e-1	SMART
LY	1337	1379	8.56e-14	SMART
LY	1380	1424	8.43e-13	SMART
LY	1425	1469	3.05e-10	SMART
LY	1471	1513	3.88e-3	SMART
EGF	1540	1580	1.85e0	SMART
LY	1606	1650	2.83e-5	SMART
LY	1651	1695	2.01e-10	SMART
LY	1698	1735	1.87e-5	SMART
LY	1736	1777	3.54e-6	SMART
LY	1778	1820	4.17e1	SMART
EGF	1850	1888	1.24e-1	SMART
LY	1915	1957	3.2e-4	SMART
LY	1958	2000	2.33e-15	SMART
LY	2001	2044	7.45e-14	SMART
LY	2045	2087	3.87e-12	SMART
LY	2089	2131	1.37e0	SMART
EGF	2159	2196	1.66e1	SMART
LY	2276	2318	5.57e-4	SMART
LY	2324	2369	3.3e-6	SMART
LY	2370	2412	3.93e-13	SMART
LY	2413	2454	3.62e-3	SMART
EGF_like	2482	2519	3.16e1	SMART
LDLa	2524	2564	3.31e-10	SMART
LDLa	2566	2603	7.21e-11	SMART
LDLa	2605	2642	1.09e-10	SMART
LDLa	2660	2691	6.05e-4	SMART
LDLa	2696	2733	2.49e-14	SMART
LDLa	2734	2772	4.65e-14	SMART
LDLa	2774	2815	3.92e-12	SMART
LDLa	2818	2856	1.51e-13	SMART
LDLa	2858	2900	1.93e-11	SMART
LDLa	2904	2942	1.73e-13	SMART
EGF_CA	2941	2982	6.16e-6	SMART
EGF_CA	2983	3023	2.66e-10	SMART
LY	3050	3094	6.64e-11	SMART
LY	3095	3137	7.17e-16	SMART
LY	3138	3181	4.28e-14	SMART
LY	3182	3224	8.11e-15	SMART
LY	3225	3265	1.44e-6	SMART
EGF	3294	3332	1.02e-2	SMART
LDLa	3334	3372	2.25e-12	SMART
LDLa	3374	3411	9.81e-13	SMART
LDLa	3413	3451	9.81e-13	SMART
LDLa	3453	3492	5.67e-18	SMART
LDLa	3494	3534	7.15e-15	SMART
LDLa	3536	3573	1.79e-15	SMART
EGF_like	3575	3611	4.83e1	SMART
LDLa	3575	3612	1.92e-15	SMART
LDLa	3613	3650	1.18e-15	SMART
LDLa	3654	3693	7.55e-14	SMART
LDLa	3695	3734	1.14e-8	SMART
LDLa	3741	3779	6.28e-11	SMART
EGF	3785	3824	1.06e1	SMART
EGF	3828	3862	1.51e0	SMART
LY	3893	3935	9.43e0	SMART
LY	3951	3993	1.23e-14	SMART
LY	3994	4037	2.98e-13	SMART
LY	4038	4080	4.28e-14	SMART
EGF	4151	4184	3.76e-1	SMART
low complexity region	4185	4198	N/A	INTRINSIC
EGF	4200	4233	3.82e-2	SMART
EGF	4236	4269	4.03e-1	SMART
EGF	4272	4305	5.2e-4	SMART
EGF	4308	4341	1.22e0	SMART
EGF_like	4344	4376	4.11e1	SMART
EGF	4377	4410	5.12e-3	SMART
transmembrane domain	4423	4445	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000118455
AA Change: S216N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000113497
Gene: ENSMUSG00000040249
AA Change: S216N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LDLa	27	67	1.03e-15	SMART
LDLa	72	111	1.04e-11	SMART
EGF	115	150	8.78e-2	SMART
EGF_CA	151	190	4.49e-8	SMART
low complexity region	222	232	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121829
AA Change: S216N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000113584
Gene: ENSMUSG00000040249
AA Change: S216N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LDLa	27	67	1.03e-15	SMART
LDLa	72	111	1.04e-11	SMART
EGF	115	150	8.78e-2	SMART
EGF_CA	151	190	4.49e-8	SMART
low complexity region	222	232	N/A	INTRINSIC
LY	273	315	7.07e-6	SMART
LY	316	359	2.31e-10	SMART
LY	360	402	8.3e-12	SMART
EGF	478	521	9.93e-1	SMART
LY	552	594	8.84e-7	SMART
LY	595	638	6.54e-10	SMART
LY	641	690	2.5e-15	SMART
LY	691	734	1.06e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125480

Meta Mutation Damage Score

0.1002

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.8%
20x: 90.8%

Validation Efficiency

97% (89/92)

MGI Phenotype

Strain: 2178192
Lethality: E10-E13
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor family of proteins. The encoded preproprotein is proteolytically processed by furin to generate 515 kDa and 85 kDa subunits that form the mature receptor (PMID: 8546712). This receptor is involved in several cellular processes, including intracellular signaling, lipid homeostasis, and clearance of apoptotic cells. In addition, the encoded protein is necessary for the alpha 2-macroglobulin-mediated clearance of secreted amyloid precursor protein and beta-amyloid, the main component of amyloid plaques found in Alzheimer patients. Expression of this gene decreases with age and has been found to be lower than controls in brain tissue from Alzheimer's disease patients. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality during late organogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(42) : Targeted(9) Gene trapped(33)

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700008P02Rik	A	G	3: 6,620,441		probably benign	Het
Aadacl2	C	T	3: 60,010,576	T82I	probably benign	Het
Acadl	T	C	1: 66,853,223	N147S	probably benign	Het
Actr3	A	T	1: 125,408,563	M79K	probably damaging	Het
Agbl3	A	G	6: 34,857,517	S874G	possibly damaging	Het
Aoah	A	T	13: 21,002,948	T472S	probably damaging	Het
Asb16	A	T	11: 102,268,995	D58V	probably damaging	Het
B4galt1	T	C	4: 40,823,575	D172G	probably benign	Het
Bax	T	C	7: 45,465,247	N55S	possibly damaging	Het
Bdkrb2	A	G	12: 105,591,859	N120D	possibly damaging	Het
Bicdl1	T	C	5: 115,651,266		probably benign	Het
Cand1	A	G	10: 119,213,566	L425P	probably damaging	Het
Caskin1	G	A	17: 24,505,478		probably null	Het
Cd248	C	T	19: 5,069,932	P603S	probably benign	Het
Cep95	G	T	11: 106,800,104	R143L	probably benign	Het
Clptm1l	G	T	13: 73,614,673		probably null	Het
Cntnap5a	T	C	1: 116,060,200	F154L	possibly damaging	Het
Cyld	A	T	8: 88,709,990	I303F	possibly damaging	Het
Dock2	A	G	11: 34,706,461	S370P	probably damaging	Het
Enah	G	T	1: 181,922,293	T327K	probably damaging	Het
Farp2	A	T	1: 93,579,860	S427C	probably damaging	Het
Fbxw11	C	T	11: 32,733,612	T301M	probably damaging	Het
Foxc2	A	T	8: 121,117,176	T188S	probably benign	Het
Fzd2	A	G	11: 102,606,328	T533A	probably benign	Het
Glb1l2	G	T	9: 26,769,038	S248*	probably null	Het
Glul	A	T	1: 153,905,538		probably benign	Het
Gm28042	A	G	2: 120,041,406	T946A	probably benign	Het
Golga3	T	A	5: 110,181,783	D2E	probably damaging	Het
Grm1	A	T	10: 10,719,967	F639Y	probably benign	Het
Gzmn	A	G	14: 56,165,911	L247P	probably benign	Het
Hgf	T	G	5: 16,613,785	I525R	probably damaging	Het
Hnrnpul2	T	A	19: 8,831,332	D719E	probably benign	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Itga9	T	C	9: 118,607,117		probably null	Het
Itgb1	T	A	8: 128,705,458	C16S	probably damaging	Het
Itgb1	G	T	8: 128,705,459	C16F	possibly damaging	Het
Kat14	A	G	2: 144,394,100	I251V	probably benign	Het
Kdsr	A	T	1: 106,734,541		probably null	Het
Kif12	T	A	4: 63,166,500	E527V	probably benign	Het
Larp1b	T	C	3: 41,033,474	S44P	probably damaging	Het
Lonp2	T	C	8: 86,673,072		probably benign	Het
Lrrc19	T	C	4: 94,640,950	S32G	probably benign	Het
Mdm2	G	A	10: 117,690,529	T335M	probably benign	Het
Mettl25	A	G	10: 105,779,632	Y504H	probably damaging	Het
Mill1	T	C	7: 18,245,647	I13T	probably benign	Het
Mmachc	T	A	4: 116,703,524	Q258L	probably benign	Het
Mpdz	T	A	4: 81,421,176	I5L	probably benign	Het
Mrps2	C	T	2: 28,469,488	A119V	probably benign	Het
Mtmr11	A	G	3: 96,168,113	T370A	probably benign	Het
Nmi	T	C	2: 51,958,977	I34V	possibly damaging	Het
Obscn	A	T	11: 59,036,075	M5538K	possibly damaging	Het
Ogdhl	T	C	14: 32,325,865	I24T	probably benign	Het
Olfr1477	C	T	19: 13,502,757	T138M	probably benign	Het
Olfr675	A	G	7: 105,024,560	V140A	probably benign	Het
Olfr703	A	G	7: 106,845,196	Y195C	possibly damaging	Het
Olfr816	A	G	10: 129,911,681	V199A	probably benign	Het
Omp	G	T	7: 98,145,359	D20E	probably benign	Het
Otog	A	G	7: 46,283,908	H1291R	probably benign	Het
Pgbd1	A	G	13: 21,423,292	L244P	probably damaging	Het
Ranbp2	A	G	10: 58,463,986	I481V	probably benign	Het
Rbp3	A	T	14: 33,955,792	I566F	probably damaging	Het
Rsph4a	A	G	10: 33,905,529	D125G	probably benign	Het
Scn11a	A	G	9: 119,769,807	V1219A	probably damaging	Het
Serpine3	G	A	14: 62,674,381	G264D	probably benign	Het
Slc4a10	T	C	2: 62,257,462	F400L	probably damaging	Het
Slco1a4	C	T	6: 141,845,447	V8I	probably benign	Het
Soga1	A	T	2: 157,027,637	M1026K	probably benign	Het
Spen	T	C	4: 141,488,024	D499G	unknown	Het
Stk32c	A	G	7: 139,119,015		probably null	Het
Tars	A	G	15: 11,388,175	V485A	probably benign	Het
Tcerg1l	A	G	7: 138,361,767	L258P	probably damaging	Het
Tmc2	A	T	2: 130,247,960	I622F	probably damaging	Het
Tmem183a	A	T	1: 134,354,706	N220K	probably damaging	Het
Tnni3	T	C	7: 4,520,526	D146G	probably damaging	Het
Trappc11	G	T	8: 47,501,680	D908E	probably damaging	Het
Trappc8	A	G	18: 20,863,551	Y436H	probably damaging	Het
Ttc41	G	A	10: 86,776,390	V1176I	probably benign	Het
Ube2b	A	G	11: 51,997,872	V24A	probably benign	Het
Usp30	T	C	5: 114,112,961	C233R	probably damaging	Het
Vmn1r87	T	A	7: 13,131,776	T195S	possibly damaging	Het
Vmn2r24	T	C	6: 123,806,520		probably benign	Het
Vmn2r81	C	A	10: 79,293,024	T583N	probably damaging	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Wdr1	C	A	5: 38,529,972	V239L	probably benign	Het
Wdr17	C	T	8: 54,703,907		probably benign	Het
Zfhx4	A	C	3: 5,241,729	D5A	probably damaging	Het
Zfyve27	T	C	19: 42,171,745		probably null	Het

Other mutations in Lrp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00793:Lrp1	APN	10	127542205	missense	possibly damaging	0.89
IGL01065:Lrp1	APN	10	127575038	missense	probably benign	0.10
IGL01121:Lrp1	APN	10	127583853	nonsense	probably null
IGL01360:Lrp1	APN	10	127545820	missense	possibly damaging	0.93
IGL01402:Lrp1	APN	10	127595032	missense	probably damaging	1.00
IGL01404:Lrp1	APN	10	127595032	missense	probably damaging	1.00
IGL01411:Lrp1	APN	10	127581765	nonsense	probably null
IGL01469:Lrp1	APN	10	127584414	missense	probably damaging	1.00
IGL01552:Lrp1	APN	10	127588510	nonsense	probably null
IGL01682:Lrp1	APN	10	127574978	missense	probably benign	0.00
IGL01760:Lrp1	APN	10	127573501	missense	probably benign	0.00
IGL01918:Lrp1	APN	10	127554589	missense	probably damaging	0.99
IGL01989:Lrp1	APN	10	127578129	missense	probably damaging	1.00
IGL02105:Lrp1	APN	10	127544579	missense	probably damaging	1.00
IGL02158:Lrp1	APN	10	127554271	missense	probably benign	0.02
IGL02164:Lrp1	APN	10	127563667	missense	probably benign	0.39
IGL02337:Lrp1	APN	10	127576887	missense	possibly damaging	0.87
IGL02425:Lrp1	APN	10	127571887	critical splice donor site	probably null
IGL02493:Lrp1	APN	10	127581778	missense	probably damaging	0.99
IGL02563:Lrp1	APN	10	127551686	missense	probably damaging	1.00
IGL02590:Lrp1	APN	10	127552791	missense	probably damaging	1.00
IGL02624:Lrp1	APN	10	127572422	missense	probably damaging	0.98
IGL02625:Lrp1	APN	10	127574486	missense	probably damaging	1.00
IGL02825:Lrp1	APN	10	127542605	missense	probably damaging	1.00
IGL02880:Lrp1	APN	10	127540222	missense	probably benign	0.12
IGL02900:Lrp1	APN	10	127576647	splice site	probably benign
IGL02956:Lrp1	APN	10	127544559	missense	probably benign	0.00
IGL02974:Lrp1	APN	10	127555016	missense	probably damaging	0.99
IGL02983:Lrp1	APN	10	127550199	missense	probably damaging	1.00
IGL03002:Lrp1	APN	10	127589636	missense	probably damaging	1.00
IGL03091:Lrp1	APN	10	127559124	missense	probably benign	0.30
IGL03109:Lrp1	APN	10	127566645	missense	probably benign
IGL03194:Lrp1	APN	10	127568685	missense	probably damaging	1.00
IGL03232:Lrp1	APN	10	127539376	missense	probably damaging	1.00
calculus	UTSW	10	127558068	splice site	probably null
Delimiter	UTSW	10	127546862	missense	probably damaging	1.00
extremis	UTSW	10	127556988	missense	probably benign	0.00
Jockey	UTSW	10	127560136	missense	probably damaging	1.00
peripheral	UTSW	10	127610381	missense	probably damaging	1.00
tangential	UTSW	10	127593848	missense	probably damaging	0.99
P0015:Lrp1	UTSW	10	127566663	missense	probably damaging	0.99
PIT4519001:Lrp1	UTSW	10	127607974	missense	possibly damaging	0.91
PIT4520001:Lrp1	UTSW	10	127607974	missense	possibly damaging	0.91
R0004:Lrp1	UTSW	10	127541825	splice site	probably null
R0034:Lrp1	UTSW	10	127545651	missense	probably benign	0.42
R0091:Lrp1	UTSW	10	127540979	missense	probably damaging	1.00
R0098:Lrp1	UTSW	10	127552738	missense	probably benign
R0098:Lrp1	UTSW	10	127552738	missense	probably benign
R0143:Lrp1	UTSW	10	127593942	missense	probably damaging	1.00
R0372:Lrp1	UTSW	10	127592136	missense	probably damaging	1.00
R0379:Lrp1	UTSW	10	127594969	missense	probably damaging	1.00
R0445:Lrp1	UTSW	10	127590636	nonsense	probably null
R0529:Lrp1	UTSW	10	127541594	splice site	probably null
R0551:Lrp1	UTSW	10	127571958	missense	probably benign
R0570:Lrp1	UTSW	10	127555009	nonsense	probably null
R0600:Lrp1	UTSW	10	127567383	missense	probably benign	0.00
R0626:Lrp1	UTSW	10	127567364	missense	probably damaging	1.00
R0647:Lrp1	UTSW	10	127571477	missense	probably damaging	1.00
R0680:Lrp1	UTSW	10	127589661	missense	probably damaging	1.00
R0792:Lrp1	UTSW	10	127567364	missense	probably damaging	1.00
R0792:Lrp1	UTSW	10	127575286	missense	probably benign	0.04
R0848:Lrp1	UTSW	10	127553362	splice site	probably null
R0866:Lrp1	UTSW	10	127539278	missense	probably damaging	1.00
R0918:Lrp1	UTSW	10	127593965	missense	probably damaging	1.00
R1076:Lrp1	UTSW	10	127563797	splice site	probably benign
R1107:Lrp1	UTSW	10	127557435	missense	probably damaging	1.00
R1346:Lrp1	UTSW	10	127605866	missense	probably damaging	1.00
R1403:Lrp1	UTSW	10	127581891	critical splice acceptor site	probably null
R1403:Lrp1	UTSW	10	127581891	critical splice acceptor site	probably null
R1496:Lrp1	UTSW	10	127539011	missense	probably damaging	1.00
R1522:Lrp1	UTSW	10	127567364	missense	probably damaging	1.00
R1522:Lrp1	UTSW	10	127575286	missense	probably benign	0.04
R1525:Lrp1	UTSW	10	127539529	missense	probably damaging	1.00
R1539:Lrp1	UTSW	10	127584381	splice site	probably null
R1591:Lrp1	UTSW	10	127605606	missense	probably benign	0.00
R1663:Lrp1	UTSW	10	127556921	missense	probably damaging	1.00
R1682:Lrp1	UTSW	10	127574332	missense	probably damaging	1.00
R1717:Lrp1	UTSW	10	127556269	missense	possibly damaging	0.59
R1717:Lrp1	UTSW	10	127563665	missense	probably damaging	1.00
R1758:Lrp1	UTSW	10	127588584	missense	possibly damaging	0.76
R1826:Lrp1	UTSW	10	127553707	missense	probably damaging	1.00
R1842:Lrp1	UTSW	10	127573468	missense	possibly damaging	0.93
R1844:Lrp1	UTSW	10	127595283	critical splice donor site	probably null
R1845:Lrp1	UTSW	10	127578673	missense	probably damaging	1.00
R1896:Lrp1	UTSW	10	127559998	missense	possibly damaging	0.64
R1952:Lrp1	UTSW	10	127567431	missense	probably damaging	1.00
R2009:Lrp1	UTSW	10	127544516	missense	probably damaging	1.00
R2015:Lrp1	UTSW	10	127540694	missense	probably benign	0.00
R2116:Lrp1	UTSW	10	127576493	nonsense	probably null
R2161:Lrp1	UTSW	10	127555738	missense	probably damaging	1.00
R2199:Lrp1	UTSW	10	127546840	missense	probably damaging	1.00
R2213:Lrp1	UTSW	10	127540702	missense	probably damaging	1.00
R2300:Lrp1	UTSW	10	127556915	nonsense	probably null
R2324:Lrp1	UTSW	10	127566586	missense	possibly damaging	0.92
R2849:Lrp1	UTSW	10	127542296	missense	probably damaging	1.00
R2926:Lrp1	UTSW	10	127588113	missense	probably damaging	0.98
R2993:Lrp1	UTSW	10	127610381	missense	probably damaging	1.00
R3522:Lrp1	UTSW	10	127553555	missense	probably damaging	1.00
R3702:Lrp1	UTSW	10	127595103	missense	probably damaging	1.00
R3789:Lrp1	UTSW	10	127571969	missense	possibly damaging	0.94
R3898:Lrp1	UTSW	10	127592100	nonsense	probably null
R3941:Lrp1	UTSW	10	127553396	missense	probably damaging	1.00
R3958:Lrp1	UTSW	10	127571958	missense	probably benign
R4369:Lrp1	UTSW	10	127550286	missense	possibly damaging	0.87
R4510:Lrp1	UTSW	10	127593848	missense	probably damaging	0.99
R4511:Lrp1	UTSW	10	127593848	missense	probably damaging	0.99
R4576:Lrp1	UTSW	10	127540188	small deletion	probably benign
R4583:Lrp1	UTSW	10	127541372	missense	probably benign	0.00
R4662:Lrp1	UTSW	10	127552185	nonsense	probably null
R4721:Lrp1	UTSW	10	127555059	missense	possibly damaging	0.58
R4728:Lrp1	UTSW	10	127563737	missense	probably damaging	1.00
R4745:Lrp1	UTSW	10	127549944	missense	probably benign	0.20
R4785:Lrp1	UTSW	10	127558133	missense	probably benign	0.12
R4841:Lrp1	UTSW	10	127583936	missense	probably damaging	1.00
R4842:Lrp1	UTSW	10	127583936	missense	probably damaging	1.00
R4855:Lrp1	UTSW	10	127610442	missense	probably benign	0.03
R4860:Lrp1	UTSW	10	127553824	missense	probably damaging	1.00
R4860:Lrp1	UTSW	10	127553824	missense	probably damaging	1.00
R4891:Lrp1	UTSW	10	127541752	missense	probably damaging	1.00
R4925:Lrp1	UTSW	10	127575075	nonsense	probably null
R4970:Lrp1	UTSW	10	127539520	missense	probably benign	0.11
R4999:Lrp1	UTSW	10	127553779	missense	probably damaging	1.00
R5044:Lrp1	UTSW	10	127567495	missense	probably damaging	1.00
R5127:Lrp1	UTSW	10	127539634	intron	probably benign
R5188:Lrp1	UTSW	10	127607952	missense	probably damaging	1.00
R5218:Lrp1	UTSW	10	127548619	missense	probably damaging	1.00
R5225:Lrp1	UTSW	10	127556096	missense	probably benign	0.04
R5291:Lrp1	UTSW	10	127593878	missense	probably damaging	1.00
R5386:Lrp1	UTSW	10	127592114	missense	probably damaging	1.00
R5395:Lrp1	UTSW	10	127595297	missense	probably damaging	1.00
R5413:Lrp1	UTSW	10	127588067	critical splice donor site	probably null
R5430:Lrp1	UTSW	10	127541061	missense	probably damaging	0.99
R5499:Lrp1	UTSW	10	127572944	missense	possibly damaging	0.58
R5526:Lrp1	UTSW	10	127555724	missense	probably benign	0.37
R5580:Lrp1	UTSW	10	127588520	missense	probably benign
R5583:Lrp1	UTSW	10	127588463	missense	probably benign	0.08
R5599:Lrp1	UTSW	10	127593869	missense	probably damaging	1.00
R5639:Lrp1	UTSW	10	127593839	missense	probably damaging	0.99
R5677:Lrp1	UTSW	10	127574429	missense	probably damaging	1.00
R5730:Lrp1	UTSW	10	127583834	missense	probably benign	0.00
R5742:Lrp1	UTSW	10	127548347	missense	probably damaging	0.98
R5764:Lrp1	UTSW	10	127595318	missense	probably benign	0.41
R5864:Lrp1	UTSW	10	127567505	missense	possibly damaging	0.58
R5937:Lrp1	UTSW	10	127583876	missense	possibly damaging	0.93
R5947:Lrp1	UTSW	10	127589554	critical splice donor site	probably null
R5976:Lrp1	UTSW	10	127583901	missense	probably damaging	1.00
R6021:Lrp1	UTSW	10	127578014	missense	probably damaging	1.00
R6026:Lrp1	UTSW	10	127573403	missense	probably damaging	1.00
R6045:Lrp1	UTSW	10	127566600	missense	probably damaging	0.98
R6057:Lrp1	UTSW	10	127567490	missense	probably damaging	1.00
R6084:Lrp1	UTSW	10	127560553	missense	probably benign	0.09
R6131:Lrp1	UTSW	10	127560157	missense	probably benign
R6235:Lrp1	UTSW	10	127588177	missense	probably damaging	1.00
R6280:Lrp1	UTSW	10	127589584	missense	probably benign	0.04
R6307:Lrp1	UTSW	10	127592075	missense	probably damaging	1.00
R6532:Lrp1	UTSW	10	127541682	missense	probably damaging	1.00
R6532:Lrp1	UTSW	10	127549407	missense	probably damaging	1.00
R6536:Lrp1	UTSW	10	127558068	splice site	probably null
R6605:Lrp1	UTSW	10	127560136	missense	probably damaging	1.00
R6607:Lrp1	UTSW	10	127560136	missense	probably damaging	1.00
R6631:Lrp1	UTSW	10	127574332	missense	probably damaging	1.00
R6676:Lrp1	UTSW	10	127560136	missense	probably damaging	1.00
R6678:Lrp1	UTSW	10	127560136	missense	probably damaging	1.00
R6809:Lrp1	UTSW	10	127555056	missense	probably benign	0.04
R6884:Lrp1	UTSW	10	127559117	missense	probably benign	0.00
R6925:Lrp1	UTSW	10	127556988	missense	probably benign	0.00
R6987:Lrp1	UTSW	10	127575005	missense	probably damaging	1.00
R7016:Lrp1	UTSW	10	127559967	critical splice donor site	probably null
R7030:Lrp1	UTSW	10	127552876	missense	probably damaging	0.97
R7053:Lrp1	UTSW	10	127541094	missense	probably damaging	1.00
R7076:Lrp1	UTSW	10	127550183	critical splice donor site	probably null
R7136:Lrp1	UTSW	10	127558622	missense	probably damaging	1.00
R7180:Lrp1	UTSW	10	127556965	missense	probably damaging	1.00
R7199:Lrp1	UTSW	10	127573456	missense	probably damaging	0.99
R7219:Lrp1	UTSW	10	127557228	missense	probably benign	0.40
R7233:Lrp1	UTSW	10	127595061	missense	probably damaging	1.00
R7251:Lrp1	UTSW	10	127572554	missense	probably damaging	1.00
R7264:Lrp1	UTSW	10	127592093	missense	probably damaging	1.00
R7302:Lrp1	UTSW	10	127538987	missense	probably benign	0.01
R7313:Lrp1	UTSW	10	127553468	missense	probably damaging	1.00
R7322:Lrp1	UTSW	10	127545564	missense	probably benign	0.24
R7354:Lrp1	UTSW	10	127571408	missense	probably damaging	1.00
R7375:Lrp1	UTSW	10	127539348	missense	probably damaging	1.00
R7388:Lrp1	UTSW	10	127583897	nonsense	probably null
R7404:Lrp1	UTSW	10	127582708	missense
R7405:Lrp1	UTSW	10	127581751	missense	possibly damaging	0.93
R7477:Lrp1	UTSW	10	127568920	missense	probably damaging	1.00
R7555:Lrp1	UTSW	10	127546862	missense	probably damaging	1.00
R7600:Lrp1	UTSW	10	127555706	missense	probably benign
R7678:Lrp1	UTSW	10	127574053	missense	probably damaging	1.00
R7679:Lrp1	UTSW	10	127588428	nonsense	probably null
R7951:Lrp1	UTSW	10	127539064	nonsense	probably null
R7964:Lrp1	UTSW	10	127575044	missense	possibly damaging	0.94
R8006:Lrp1	UTSW	10	127589619	missense	probably damaging	1.00
R8021:Lrp1	UTSW	10	127548346	missense	possibly damaging	0.92
R8098:Lrp1	UTSW	10	127574455	missense	possibly damaging	0.78
R8112:Lrp1	UTSW	10	127605846	missense	probably damaging	1.00
R8210:Lrp1	UTSW	10	127576485	missense	probably damaging	1.00
R8249:Lrp1	UTSW	10	127605543	missense	probably benign
R8291:Lrp1	UTSW	10	127589703	missense	probably damaging	1.00
R8332:Lrp1	UTSW	10	127571936	missense	probably damaging	1.00
R8435:Lrp1	UTSW	10	127556330	missense	probably damaging	0.97
R8467:Lrp1	UTSW	10	127558650	missense	probably damaging	1.00
R8468:Lrp1	UTSW	10	127558650	missense	probably damaging	1.00
R8474:Lrp1	UTSW	10	127539703	missense	probably damaging	1.00
R8481:Lrp1	UTSW	10	127568910	missense	probably damaging	1.00
R8483:Lrp1	UTSW	10	127558650	missense	probably damaging	1.00
R8485:Lrp1	UTSW	10	127558650	missense	probably damaging	1.00
R8488:Lrp1	UTSW	10	127560487	missense	probably damaging	1.00
R8715:Lrp1	UTSW	10	127560621	missense	possibly damaging	0.77
R8790:Lrp1	UTSW	10	127539077	missense	probably damaging	1.00
R8854:Lrp1	UTSW	10	127543099	missense	probably damaging	1.00
R8926:Lrp1	UTSW	10	127545802	missense	probably benign
R8949:Lrp1	UTSW	10	127589536	intron	probably benign
R8971:Lrp1	UTSW	10	127556027	missense	possibly damaging	0.94
R9103:Lrp1	UTSW	10	127595110	nonsense	probably null
R9108:Lrp1	UTSW	10	127554337	missense	probably damaging	0.99
R9130:Lrp1	UTSW	10	127546412	missense	probably benign	0.18
R9157:Lrp1	UTSW	10	127574340	missense	probably damaging	1.00
R9162:Lrp1	UTSW	10	127605499	missense	probably benign	0.32
R9205:Lrp1	UTSW	10	127594981	nonsense	probably null
R9228:Lrp1	UTSW	10	127546938	missense	probably damaging	0.98
R9231:Lrp1	UTSW	10	127546399	missense	probably benign	0.06
R9287:Lrp1	UTSW	10	127567364	missense	probably damaging	1.00
R9381:Lrp1	UTSW	10	127605468	missense	probably benign	0.17
R9412:Lrp1	UTSW	10	127573418	missense	probably damaging	1.00
R9434:Lrp1	UTSW	10	127545820	missense	possibly damaging	0.93
R9463:Lrp1	UTSW	10	127593465	nonsense	probably null
R9526:Lrp1	UTSW	10	127595360	missense	probably damaging	0.96
R9548:Lrp1	UTSW	10	127552864	missense	probably damaging	0.99
R9599:Lrp1	UTSW	10	127574377	missense	probably damaging	1.00
R9649:Lrp1	UTSW	10	127573499	missense	probably benign	0.14
R9687:Lrp1	UTSW	10	127566693	missense	probably damaging	1.00
R9707:Lrp1	UTSW	10	127572545	missense	probably benign	0.08
R9770:Lrp1	UTSW	10	127584399	missense	probably damaging	1.00
V3553:Lrp1	UTSW	10	127571442	missense	probably damaging	1.00
Y5406:Lrp1	UTSW	10	127554283	missense	probably damaging	1.00
Z1088:Lrp1	UTSW	10	127584379	missense	probably damaging	1.00
Z1176:Lrp1	UTSW	10	127554962	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTATGCTCATCCACAAAGCCCTTC -3'
(R):5'- TGCACCAACACAGATGGCTCCTTC -3'

Sequencing Primer
(F):5'- AAAGCCCTTCAGGCCAGG -3'
(R):5'- TGAAGGCTACCTGCTGCAAC -3'

Posted On

2014-04-24