Incidental Mutation 'R1589:Fbxw11'
ID177750
Institutional Source Beutler Lab
Gene Symbol Fbxw11
Ensembl Gene ENSMUSG00000020271
Gene NameF-box and WD-40 domain protein 11
SynonymsHOS, 2310065A07Rik, Fbxw1b, BTRC2, BTRCP2
MMRRC Submission 039626-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R1589 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location32642724-32746816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32733612 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 301 (T301M)
Ref Sequence ENSEMBL: ENSMUSP00000090893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076383] [ENSMUST00000093205] [ENSMUST00000109366]
Predicted Effect probably damaging
Transcript: ENSMUST00000076383
AA Change: T322M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075721
Gene: ENSMUSG00000020271
AA Change: T322M

DomainStartEndE-ValueType
Beta-TrCP_D 98 137 5.48e-26 SMART
FBOX 149 188 5.08e-6 SMART
WD40 250 287 6.89e-3 SMART
WD40 290 327 3.78e-9 SMART
WD40 330 367 7.73e-6 SMART
WD40 373 410 9.67e-7 SMART
WD40 413 450 3.93e-7 SMART
WD40 453 490 8.42e-7 SMART
WD40 502 539 2.48e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093205
AA Change: T301M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090893
Gene: ENSMUSG00000020271
AA Change: T301M

DomainStartEndE-ValueType
Beta-TrCP_D 77 116 5.48e-26 SMART
FBOX 128 167 5.08e-6 SMART
WD40 229 266 6.89e-3 SMART
WD40 269 306 3.78e-9 SMART
WD40 309 346 7.73e-6 SMART
WD40 352 389 9.67e-7 SMART
WD40 392 429 3.93e-7 SMART
WD40 432 469 8.42e-7 SMART
WD40 481 518 2.48e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109366
AA Change: T288M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104991
Gene: ENSMUSG00000020271
AA Change: T288M

DomainStartEndE-ValueType
Beta-TrCP_D 64 103 5.48e-26 SMART
FBOX 115 154 5.08e-6 SMART
WD40 216 253 6.89e-3 SMART
WD40 256 293 3.78e-9 SMART
WD40 296 333 7.73e-6 SMART
WD40 339 376 9.67e-7 SMART
WD40 379 416 3.93e-7 SMART
WD40 419 456 8.42e-7 SMART
WD40 468 505 2.48e-4 SMART
Meta Mutation Damage Score 0.5727 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class and, in addition to an F-box, contains multiple WD40 repeats. This gene contains at least 14 exons, and its alternative splicing generates 3 transcript variants diverging at the presence/absence of two alternate exons. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,620,441 probably benign Het
Aadacl2 C T 3: 60,010,576 T82I probably benign Het
Acadl T C 1: 66,853,223 N147S probably benign Het
Actr3 A T 1: 125,408,563 M79K probably damaging Het
Agbl3 A G 6: 34,857,517 S874G possibly damaging Het
Aoah A T 13: 21,002,948 T472S probably damaging Het
Asb16 A T 11: 102,268,995 D58V probably damaging Het
B4galt1 T C 4: 40,823,575 D172G probably benign Het
Bax T C 7: 45,465,247 N55S possibly damaging Het
Bdkrb2 A G 12: 105,591,859 N120D possibly damaging Het
Bicdl1 T C 5: 115,651,266 probably benign Het
Cand1 A G 10: 119,213,566 L425P probably damaging Het
Caskin1 G A 17: 24,505,478 probably null Het
Cd248 C T 19: 5,069,932 P603S probably benign Het
Cep95 G T 11: 106,800,104 R143L probably benign Het
Clptm1l G T 13: 73,614,673 probably null Het
Cntnap5a T C 1: 116,060,200 F154L possibly damaging Het
Cyld A T 8: 88,709,990 I303F possibly damaging Het
Dock2 A G 11: 34,706,461 S370P probably damaging Het
Enah G T 1: 181,922,293 T327K probably damaging Het
Farp2 A T 1: 93,579,860 S427C probably damaging Het
Foxc2 A T 8: 121,117,176 T188S probably benign Het
Fzd2 A G 11: 102,606,328 T533A probably benign Het
Glb1l2 G T 9: 26,769,038 S248* probably null Het
Glul A T 1: 153,905,538 probably benign Het
Gm28042 A G 2: 120,041,406 T946A probably benign Het
Golga3 T A 5: 110,181,783 D2E probably damaging Het
Grm1 A T 10: 10,719,967 F639Y probably benign Het
Gzmn A G 14: 56,165,911 L247P probably benign Het
Hgf T G 5: 16,613,785 I525R probably damaging Het
Hnrnpul2 T A 19: 8,831,332 D719E probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itga9 T C 9: 118,607,117 probably null Het
Itgb1 T A 8: 128,705,458 C16S probably damaging Het
Itgb1 G T 8: 128,705,459 C16F possibly damaging Het
Kat14 A G 2: 144,394,100 I251V probably benign Het
Kdsr A T 1: 106,734,541 probably null Het
Kif12 T A 4: 63,166,500 E527V probably benign Het
Larp1b T C 3: 41,033,474 S44P probably damaging Het
Lonp2 T C 8: 86,673,072 probably benign Het
Lrp1 C T 10: 127,605,606 S216N probably benign Het
Lrrc19 T C 4: 94,640,950 S32G probably benign Het
Mdm2 G A 10: 117,690,529 T335M probably benign Het
Mettl25 A G 10: 105,779,632 Y504H probably damaging Het
Mill1 T C 7: 18,245,647 I13T probably benign Het
Mmachc T A 4: 116,703,524 Q258L probably benign Het
Mpdz T A 4: 81,421,176 I5L probably benign Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Mtmr11 A G 3: 96,168,113 T370A probably benign Het
Nmi T C 2: 51,958,977 I34V possibly damaging Het
Obscn A T 11: 59,036,075 M5538K possibly damaging Het
Ogdhl T C 14: 32,325,865 I24T probably benign Het
Olfr1477 C T 19: 13,502,757 T138M probably benign Het
Olfr675 A G 7: 105,024,560 V140A probably benign Het
Olfr703 A G 7: 106,845,196 Y195C possibly damaging Het
Olfr816 A G 10: 129,911,681 V199A probably benign Het
Omp G T 7: 98,145,359 D20E probably benign Het
Otog A G 7: 46,283,908 H1291R probably benign Het
Pgbd1 A G 13: 21,423,292 L244P probably damaging Het
Ranbp2 A G 10: 58,463,986 I481V probably benign Het
Rbp3 A T 14: 33,955,792 I566F probably damaging Het
Rsph4a A G 10: 33,905,529 D125G probably benign Het
Scn11a A G 9: 119,769,807 V1219A probably damaging Het
Serpine3 G A 14: 62,674,381 G264D probably benign Het
Slc4a10 T C 2: 62,257,462 F400L probably damaging Het
Slco1a4 C T 6: 141,845,447 V8I probably benign Het
Soga1 A T 2: 157,027,637 M1026K probably benign Het
Spen T C 4: 141,488,024 D499G unknown Het
Stk32c A G 7: 139,119,015 probably null Het
Tars A G 15: 11,388,175 V485A probably benign Het
Tcerg1l A G 7: 138,361,767 L258P probably damaging Het
Tmc2 A T 2: 130,247,960 I622F probably damaging Het
Tmem183a A T 1: 134,354,706 N220K probably damaging Het
Tnni3 T C 7: 4,520,526 D146G probably damaging Het
Trappc11 G T 8: 47,501,680 D908E probably damaging Het
Trappc8 A G 18: 20,863,551 Y436H probably damaging Het
Ttc41 G A 10: 86,776,390 V1176I probably benign Het
Ube2b A G 11: 51,997,872 V24A probably benign Het
Usp30 T C 5: 114,112,961 C233R probably damaging Het
Vmn1r87 T A 7: 13,131,776 T195S possibly damaging Het
Vmn2r24 T C 6: 123,806,520 probably benign Het
Vmn2r81 C A 10: 79,293,024 T583N probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr1 C A 5: 38,529,972 V239L probably benign Het
Wdr17 C T 8: 54,703,907 probably benign Het
Zfhx4 A C 3: 5,241,729 D5A probably damaging Het
Zfyve27 T C 19: 42,171,745 probably null Het
Other mutations in Fbxw11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Fbxw11 APN 11 32722101 missense possibly damaging 0.94
IGL01828:Fbxw11 APN 11 32720505 missense probably damaging 1.00
PIT4651001:Fbxw11 UTSW 11 32711999 critical splice donor site probably null
R0311:Fbxw11 UTSW 11 32722083 missense probably benign 0.00
R0331:Fbxw11 UTSW 11 32711895 missense probably damaging 0.99
R0597:Fbxw11 UTSW 11 32720496 missense probably damaging 1.00
R0989:Fbxw11 UTSW 11 32735149 missense probably benign 0.17
R1175:Fbxw11 UTSW 11 32711922 missense probably damaging 0.96
R1327:Fbxw11 UTSW 11 32711859 missense probably benign 0.00
R3155:Fbxw11 UTSW 11 32739244 missense possibly damaging 0.93
R4084:Fbxw11 UTSW 11 32739248 missense probably damaging 1.00
R4610:Fbxw11 UTSW 11 32711859 missense possibly damaging 0.48
R4677:Fbxw11 UTSW 11 32742535 nonsense probably null
R4694:Fbxw11 UTSW 11 32642820 unclassified probably benign
R4946:Fbxw11 UTSW 11 32739226 missense probably damaging 1.00
R5027:Fbxw11 UTSW 11 32652811 intron probably benign
R5345:Fbxw11 UTSW 11 32738471 missense probably damaging 1.00
R5459:Fbxw11 UTSW 11 32739191 missense possibly damaging 0.85
R5802:Fbxw11 UTSW 11 32711790 missense probably benign 0.18
R5820:Fbxw11 UTSW 11 32735374 missense probably damaging 1.00
R6181:Fbxw11 UTSW 11 32742575 missense probably benign
R6365:Fbxw11 UTSW 11 32720623 missense possibly damaging 0.75
R6948:Fbxw11 UTSW 11 32742597 missense probably damaging 0.98
R7251:Fbxw11 UTSW 11 32731370 missense probably benign 0.00
R7475:Fbxw11 UTSW 11 32711999 critical splice donor site probably null
X0064:Fbxw11 UTSW 11 32711859 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACCATAAGGAAAGCCGTGTGAC -3'
(R):5'- TGGCTAGGAGAGCATAGTGCCATC -3'

Sequencing Primer
(F):5'- AAAGCCGTGTGACTATTCTGC -3'
(R):5'- GGAGAGCATAGTGCCATCTCTATAC -3'
Posted On2014-04-24