Incidental Mutation 'R1589:Vwa8'
ID 177765
Institutional Source Beutler Lab
Gene Symbol Vwa8
Ensembl Gene ENSMUSG00000058997
Gene Name von Willebrand factor A domain containing 8
Synonyms 1300010F03Rik, 4932416F07Rik
MMRRC Submission 039626-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1589 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 79086492-79439750 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 79145670 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 116 (R116C)
Ref Sequence ENSEMBL: ENSMUSP00000154270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040990] [ENSMUST00000227255]
AlphaFold Q8CC88
Predicted Effect probably damaging
Transcript: ENSMUST00000040990
AA Change: R116C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048925
Gene: ENSMUSG00000058997
AA Change: R116C

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 20 33 N/A INTRINSIC
Pfam:AAA_5 104 260 6.3e-44 PFAM
AAA 438 613 4.69e-2 SMART
AAA 772 904 1.26e-1 SMART
low complexity region 1213 1221 N/A INTRINSIC
low complexity region 1565 1586 N/A INTRINSIC
VWA 1712 1901 2.71e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000227255
AA Change: R116C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228884
Meta Mutation Damage Score 0.6901 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.8%
Validation Efficiency 97% (89/92)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik A G 3: 6,685,501 (GRCm39) probably benign Het
Aadacl2 C T 3: 59,917,997 (GRCm39) T82I probably benign Het
Acadl T C 1: 66,892,382 (GRCm39) N147S probably benign Het
Actr3 A T 1: 125,336,300 (GRCm39) M79K probably damaging Het
Agbl3 A G 6: 34,834,452 (GRCm39) S874G possibly damaging Het
Aoah A T 13: 21,187,118 (GRCm39) T472S probably damaging Het
Asb16 A T 11: 102,159,821 (GRCm39) D58V probably damaging Het
B4galt1 T C 4: 40,823,575 (GRCm39) D172G probably benign Het
Bax T C 7: 45,114,671 (GRCm39) N55S possibly damaging Het
Bdkrb2 A G 12: 105,558,118 (GRCm39) N120D possibly damaging Het
Bicdl1 T C 5: 115,789,325 (GRCm39) probably benign Het
Cand1 A G 10: 119,049,471 (GRCm39) L425P probably damaging Het
Caskin1 G A 17: 24,724,452 (GRCm39) probably null Het
Cd248 C T 19: 5,119,960 (GRCm39) P603S probably benign Het
Cep95 G T 11: 106,690,930 (GRCm39) R143L probably benign Het
Clptm1l G T 13: 73,762,792 (GRCm39) probably null Het
Cntnap5a T C 1: 115,987,930 (GRCm39) F154L possibly damaging Het
Cyld A T 8: 89,436,618 (GRCm39) I303F possibly damaging Het
Dock2 A G 11: 34,597,288 (GRCm39) S370P probably damaging Het
Enah G T 1: 181,749,858 (GRCm39) T327K probably damaging Het
Farp2 A T 1: 93,507,582 (GRCm39) S427C probably damaging Het
Fbxw11 C T 11: 32,683,612 (GRCm39) T301M probably damaging Het
Foxc2 A T 8: 121,843,915 (GRCm39) T188S probably benign Het
Fzd2 A G 11: 102,497,154 (GRCm39) T533A probably benign Het
Glb1l2 G T 9: 26,680,334 (GRCm39) S248* probably null Het
Glul A T 1: 153,781,284 (GRCm39) probably benign Het
Gm28042 A G 2: 119,871,887 (GRCm39) T946A probably benign Het
Golga3 T A 5: 110,329,649 (GRCm39) D2E probably damaging Het
Grm1 A T 10: 10,595,711 (GRCm39) F639Y probably benign Het
Gzmn A G 14: 56,403,368 (GRCm39) L247P probably benign Het
Hgf T G 5: 16,818,783 (GRCm39) I525R probably damaging Het
Hnrnpul2 T A 19: 8,808,696 (GRCm39) D719E probably benign Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Itga9 T C 9: 118,436,185 (GRCm39) probably null Het
Itgb1 T A 8: 129,431,939 (GRCm39) C16S probably damaging Het
Itgb1 G T 8: 129,431,940 (GRCm39) C16F possibly damaging Het
Kat14 A G 2: 144,236,020 (GRCm39) I251V probably benign Het
Kdsr A T 1: 106,662,271 (GRCm39) probably null Het
Kif12 T A 4: 63,084,737 (GRCm39) E527V probably benign Het
Larp1b T C 3: 40,987,909 (GRCm39) S44P probably damaging Het
Lonp2 T C 8: 87,399,700 (GRCm39) probably benign Het
Lrp1 C T 10: 127,441,475 (GRCm39) S216N probably benign Het
Lrrc19 T C 4: 94,529,187 (GRCm39) S32G probably benign Het
Mdm2 G A 10: 117,526,434 (GRCm39) T335M probably benign Het
Mettl25 A G 10: 105,615,493 (GRCm39) Y504H probably damaging Het
Mill1 T C 7: 17,979,572 (GRCm39) I13T probably benign Het
Mmachc T A 4: 116,560,721 (GRCm39) Q258L probably benign Het
Mpdz T A 4: 81,339,413 (GRCm39) I5L probably benign Het
Mrps2 C T 2: 28,359,500 (GRCm39) A119V probably benign Het
Mtcl2 A T 2: 156,869,557 (GRCm39) M1026K probably benign Het
Mtmr11 A G 3: 96,075,429 (GRCm39) T370A probably benign Het
Nmi T C 2: 51,848,989 (GRCm39) I34V possibly damaging Het
Obscn A T 11: 58,926,901 (GRCm39) M5538K possibly damaging Het
Ogdhl T C 14: 32,047,822 (GRCm39) I24T probably benign Het
Omp G T 7: 97,794,566 (GRCm39) D20E probably benign Het
Or2ag19 A G 7: 106,444,403 (GRCm39) Y195C possibly damaging Het
Or52e8b A G 7: 104,673,767 (GRCm39) V140A probably benign Het
Or5b120 C T 19: 13,480,121 (GRCm39) T138M probably benign Het
Or6c69 A G 10: 129,747,550 (GRCm39) V199A probably benign Het
Otog A G 7: 45,933,332 (GRCm39) H1291R probably benign Het
Pgbd1 A G 13: 21,607,462 (GRCm39) L244P probably damaging Het
Ranbp2 A G 10: 58,299,808 (GRCm39) I481V probably benign Het
Rbp3 A T 14: 33,677,749 (GRCm39) I566F probably damaging Het
Rsph4a A G 10: 33,781,525 (GRCm39) D125G probably benign Het
Scn11a A G 9: 119,598,873 (GRCm39) V1219A probably damaging Het
Serpine3 G A 14: 62,911,830 (GRCm39) G264D probably benign Het
Slc4a10 T C 2: 62,087,806 (GRCm39) F400L probably damaging Het
Slco1a4 C T 6: 141,791,173 (GRCm39) V8I probably benign Het
Spen T C 4: 141,215,335 (GRCm39) D499G unknown Het
Stk32c A G 7: 138,698,931 (GRCm39) probably null Het
Tars1 A G 15: 11,388,261 (GRCm39) V485A probably benign Het
Tcerg1l A G 7: 137,963,496 (GRCm39) L258P probably damaging Het
Tmc2 A T 2: 130,089,880 (GRCm39) I622F probably damaging Het
Tmem183a A T 1: 134,282,444 (GRCm39) N220K probably damaging Het
Tnni3 T C 7: 4,523,525 (GRCm39) D146G probably damaging Het
Trappc11 G T 8: 47,954,715 (GRCm39) D908E probably damaging Het
Trappc8 A G 18: 20,996,608 (GRCm39) Y436H probably damaging Het
Ttc41 G A 10: 86,612,254 (GRCm39) V1176I probably benign Het
Ube2b A G 11: 51,888,699 (GRCm39) V24A probably benign Het
Usp30 T C 5: 114,251,022 (GRCm39) C233R probably damaging Het
Vmn1r87 T A 7: 12,865,703 (GRCm39) T195S possibly damaging Het
Vmn2r24 T C 6: 123,783,479 (GRCm39) probably benign Het
Vmn2r81 C A 10: 79,128,858 (GRCm39) T583N probably damaging Het
Wdr1 C A 5: 38,687,315 (GRCm39) V239L probably benign Het
Wdr17 C T 8: 55,156,942 (GRCm39) probably benign Het
Zfhx4 A C 3: 5,306,789 (GRCm39) D5A probably damaging Het
Zfyve27 T C 19: 42,160,184 (GRCm39) probably null Het
Other mutations in Vwa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Vwa8 APN 14 79,275,635 (GRCm39) missense probably damaging 1.00
IGL01087:Vwa8 APN 14 79,172,669 (GRCm39) missense probably benign 0.16
IGL01137:Vwa8 APN 14 79,341,087 (GRCm39) missense probably damaging 1.00
IGL01359:Vwa8 APN 14 79,302,353 (GRCm39) nonsense probably null
IGL01449:Vwa8 APN 14 79,420,428 (GRCm39) nonsense probably null
IGL01604:Vwa8 APN 14 79,418,244 (GRCm39) missense possibly damaging 0.82
IGL01636:Vwa8 APN 14 79,435,794 (GRCm39) missense possibly damaging 0.68
IGL01815:Vwa8 APN 14 79,435,717 (GRCm39) missense possibly damaging 0.92
IGL02024:Vwa8 APN 14 79,331,724 (GRCm39) missense possibly damaging 0.91
IGL02033:Vwa8 APN 14 79,221,649 (GRCm39) missense possibly damaging 0.89
IGL02154:Vwa8 APN 14 79,086,733 (GRCm39) missense possibly damaging 0.53
IGL02286:Vwa8 APN 14 79,184,713 (GRCm39) critical splice donor site probably null
IGL02393:Vwa8 APN 14 79,420,417 (GRCm39) missense probably damaging 1.00
IGL02430:Vwa8 APN 14 79,172,085 (GRCm39) critical splice donor site probably null
IGL02476:Vwa8 APN 14 79,162,781 (GRCm39) missense possibly damaging 0.62
IGL02612:Vwa8 APN 14 79,420,552 (GRCm39) missense probably benign 0.01
IGL02678:Vwa8 APN 14 79,221,640 (GRCm39) missense probably damaging 0.99
IGL02797:Vwa8 APN 14 79,162,702 (GRCm39) missense probably benign 0.29
IGL02806:Vwa8 APN 14 79,394,528 (GRCm39) missense probably benign 0.35
IGL02811:Vwa8 APN 14 79,231,899 (GRCm39) missense probably benign 0.21
IGL02892:Vwa8 APN 14 79,341,140 (GRCm39) splice site probably benign
IGL03024:Vwa8 APN 14 79,232,538 (GRCm39) missense probably benign 0.03
IGL03075:Vwa8 APN 14 79,171,196 (GRCm39) missense probably damaging 0.99
IGL03090:Vwa8 APN 14 79,172,041 (GRCm39) missense possibly damaging 0.92
IGL03124:Vwa8 APN 14 79,296,255 (GRCm39) splice site probably benign
IGL03181:Vwa8 APN 14 79,246,690 (GRCm39) missense probably benign 0.01
IGL03296:Vwa8 APN 14 79,420,540 (GRCm39) missense probably damaging 0.98
IGL03376:Vwa8 APN 14 79,420,574 (GRCm39) splice site probably null
R6812_Vwa8_870 UTSW 14 79,434,859 (GRCm39) missense probably damaging 0.99
IGL03052:Vwa8 UTSW 14 79,302,361 (GRCm39) missense probably benign 0.02
PIT4468001:Vwa8 UTSW 14 79,420,501 (GRCm39) missense probably damaging 1.00
R0049:Vwa8 UTSW 14 79,331,179 (GRCm39) missense probably benign 0.21
R0063:Vwa8 UTSW 14 79,401,656 (GRCm39) splice site probably benign
R0063:Vwa8 UTSW 14 79,401,656 (GRCm39) splice site probably benign
R0081:Vwa8 UTSW 14 79,320,222 (GRCm39) missense probably benign 0.02
R0305:Vwa8 UTSW 14 79,246,713 (GRCm39) missense probably damaging 1.00
R0433:Vwa8 UTSW 14 79,300,116 (GRCm39) missense probably damaging 1.00
R0514:Vwa8 UTSW 14 79,184,629 (GRCm39) missense probably benign
R0602:Vwa8 UTSW 14 79,258,060 (GRCm39) missense probably benign 0.00
R0615:Vwa8 UTSW 14 79,145,590 (GRCm39) missense probably benign
R0791:Vwa8 UTSW 14 79,232,016 (GRCm39) splice site probably benign
R1028:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1037:Vwa8 UTSW 14 79,324,094 (GRCm39) nonsense probably null
R1404:Vwa8 UTSW 14 79,263,471 (GRCm39) missense probably damaging 1.00
R1404:Vwa8 UTSW 14 79,263,471 (GRCm39) missense probably damaging 1.00
R1412:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1421:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1467:Vwa8 UTSW 14 79,341,134 (GRCm39) nonsense probably null
R1467:Vwa8 UTSW 14 79,341,134 (GRCm39) nonsense probably null
R1539:Vwa8 UTSW 14 79,300,002 (GRCm39) missense probably benign 0.00
R1556:Vwa8 UTSW 14 79,324,121 (GRCm39) missense probably benign
R1590:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1591:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1645:Vwa8 UTSW 14 79,420,427 (GRCm39) missense probably damaging 1.00
R1673:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R1688:Vwa8 UTSW 14 79,438,543 (GRCm39) missense possibly damaging 0.72
R1764:Vwa8 UTSW 14 79,145,635 (GRCm39) missense probably damaging 1.00
R1830:Vwa8 UTSW 14 79,318,576 (GRCm39) missense probably benign 0.04
R1926:Vwa8 UTSW 14 79,258,075 (GRCm39) missense probably benign 0.00
R1959:Vwa8 UTSW 14 79,219,800 (GRCm39) missense possibly damaging 0.95
R1971:Vwa8 UTSW 14 79,162,694 (GRCm39) splice site probably benign
R2078:Vwa8 UTSW 14 79,145,597 (GRCm39) missense probably damaging 1.00
R2103:Vwa8 UTSW 14 79,145,670 (GRCm39) missense probably damaging 1.00
R2230:Vwa8 UTSW 14 79,329,843 (GRCm39) critical splice donor site probably null
R2281:Vwa8 UTSW 14 79,302,436 (GRCm39) missense possibly damaging 0.91
R2313:Vwa8 UTSW 14 79,149,658 (GRCm39) missense probably damaging 0.98
R2847:Vwa8 UTSW 14 79,184,582 (GRCm39) missense probably benign 0.00
R2848:Vwa8 UTSW 14 79,184,582 (GRCm39) missense probably benign 0.00
R2894:Vwa8 UTSW 14 79,275,578 (GRCm39) missense probably damaging 1.00
R2991:Vwa8 UTSW 14 79,232,589 (GRCm39) missense probably benign 0.00
R3077:Vwa8 UTSW 14 79,335,782 (GRCm39) missense probably benign 0.03
R3405:Vwa8 UTSW 14 79,401,660 (GRCm39) splice site probably benign
R3406:Vwa8 UTSW 14 79,401,660 (GRCm39) splice site probably benign
R3708:Vwa8 UTSW 14 79,300,136 (GRCm39) splice site probably benign
R3779:Vwa8 UTSW 14 79,339,762 (GRCm39) splice site probably benign
R3799:Vwa8 UTSW 14 79,302,336 (GRCm39) missense probably damaging 0.99
R4230:Vwa8 UTSW 14 79,320,292 (GRCm39) missense probably benign 0.00
R4425:Vwa8 UTSW 14 79,320,246 (GRCm39) missense probably benign 0.00
R4478:Vwa8 UTSW 14 79,106,241 (GRCm39) missense probably benign 0.00
R4627:Vwa8 UTSW 14 79,341,137 (GRCm39) critical splice donor site probably null
R4835:Vwa8 UTSW 14 79,172,053 (GRCm39) missense probably benign 0.11
R4868:Vwa8 UTSW 14 79,420,522 (GRCm39) missense probably damaging 1.00
R4988:Vwa8 UTSW 14 79,435,723 (GRCm39) missense probably benign 0.05
R5137:Vwa8 UTSW 14 79,302,342 (GRCm39) missense probably damaging 1.00
R5156:Vwa8 UTSW 14 79,221,666 (GRCm39) missense probably benign 0.00
R5658:Vwa8 UTSW 14 79,219,838 (GRCm39) critical splice donor site probably null
R5841:Vwa8 UTSW 14 79,231,958 (GRCm39) missense probably benign
R6057:Vwa8 UTSW 14 79,320,313 (GRCm39) missense probably benign 0.21
R6244:Vwa8 UTSW 14 79,324,102 (GRCm39) missense probably benign
R6264:Vwa8 UTSW 14 79,324,252 (GRCm39) missense possibly damaging 0.64
R6290:Vwa8 UTSW 14 79,331,772 (GRCm39) splice site probably null
R6332:Vwa8 UTSW 14 79,434,904 (GRCm39) missense probably benign
R6395:Vwa8 UTSW 14 79,331,184 (GRCm39) missense probably benign 0.02
R6472:Vwa8 UTSW 14 79,246,610 (GRCm39) missense possibly damaging 0.71
R6497:Vwa8 UTSW 14 79,333,841 (GRCm39) missense probably benign 0.00
R6527:Vwa8 UTSW 14 79,184,653 (GRCm39) missense possibly damaging 0.73
R6552:Vwa8 UTSW 14 79,435,662 (GRCm39) missense possibly damaging 0.80
R6812:Vwa8 UTSW 14 79,434,859 (GRCm39) missense probably damaging 0.99
R6994:Vwa8 UTSW 14 79,145,596 (GRCm39) missense possibly damaging 0.90
R7040:Vwa8 UTSW 14 79,149,645 (GRCm39) missense probably damaging 1.00
R7357:Vwa8 UTSW 14 79,275,641 (GRCm39) missense probably null 1.00
R7363:Vwa8 UTSW 14 79,256,147 (GRCm39) missense probably benign 0.05
R7381:Vwa8 UTSW 14 79,333,125 (GRCm39) missense probably benign 0.00
R7406:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7408:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7409:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7410:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7483:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7484:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7491:Vwa8 UTSW 14 79,320,254 (GRCm39) missense probably benign 0.24
R7500:Vwa8 UTSW 14 79,162,686 (GRCm39) splice site probably null
R7514:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7582:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7584:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7585:Vwa8 UTSW 14 79,219,674 (GRCm39) critical splice acceptor site probably null
R7647:Vwa8 UTSW 14 79,172,669 (GRCm39) missense probably damaging 0.99
R7685:Vwa8 UTSW 14 79,335,740 (GRCm39) missense probably benign
R7703:Vwa8 UTSW 14 79,263,513 (GRCm39) missense probably damaging 1.00
R7730:Vwa8 UTSW 14 79,232,589 (GRCm39) missense probably benign 0.00
R7775:Vwa8 UTSW 14 79,275,587 (GRCm39) missense probably benign 0.03
R7778:Vwa8 UTSW 14 79,275,587 (GRCm39) missense probably benign 0.03
R7824:Vwa8 UTSW 14 79,275,587 (GRCm39) missense probably benign 0.03
R7885:Vwa8 UTSW 14 79,258,089 (GRCm39) missense probably benign 0.00
R7902:Vwa8 UTSW 14 79,329,731 (GRCm39) missense probably benign 0.00
R8262:Vwa8 UTSW 14 79,171,272 (GRCm39) critical splice donor site probably null
R8458:Vwa8 UTSW 14 79,302,332 (GRCm39) missense probably damaging 1.00
R8495:Vwa8 UTSW 14 79,174,617 (GRCm39) nonsense probably null
R8557:Vwa8 UTSW 14 79,246,649 (GRCm39) missense probably damaging 1.00
R8841:Vwa8 UTSW 14 79,184,702 (GRCm39) missense probably benign 0.04
R8906:Vwa8 UTSW 14 79,329,815 (GRCm39) missense probably benign 0.00
R8947:Vwa8 UTSW 14 79,438,552 (GRCm39) missense probably damaging 1.00
R9034:Vwa8 UTSW 14 79,296,179 (GRCm39) missense probably damaging 1.00
R9051:Vwa8 UTSW 14 79,324,150 (GRCm39) missense probably benign 0.00
R9179:Vwa8 UTSW 14 79,335,801 (GRCm39) missense probably benign
R9433:Vwa8 UTSW 14 79,335,871 (GRCm39) critical splice donor site probably null
R9455:Vwa8 UTSW 14 79,300,115 (GRCm39) missense probably damaging 1.00
R9496:Vwa8 UTSW 14 79,258,122 (GRCm39) missense probably benign
R9530:Vwa8 UTSW 14 79,172,639 (GRCm39) missense probably benign 0.33
R9584:Vwa8 UTSW 14 79,394,549 (GRCm39) missense probably benign
R9763:Vwa8 UTSW 14 79,186,988 (GRCm39) missense probably damaging 1.00
Z1088:Vwa8 UTSW 14 79,219,686 (GRCm39) missense probably benign 0.38
Z1177:Vwa8 UTSW 14 79,296,132 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCTCTCACTGGCTTTGAAATGG -3'
(R):5'- GCACTGCCTGATGACAGCAATACC -3'

Sequencing Primer
(F):5'- tctatctgtcatctatccatccatc -3'
(R):5'- TGATGACAGCAATACCTAAAACTAC -3'
Posted On 2014-04-24