Incidental Mutation 'R1590:Mcmdc2'
ID177775
Institutional Source Beutler Lab
Gene Symbol Mcmdc2
Ensembl Gene ENSMUSG00000046101
Gene Nameminichromosome maintenance domain containing 2
Synonyms
MMRRC Submission 039627-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R1590 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location9908638-9942085 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 9916555 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 204 (Q204*)
Ref Sequence ENSEMBL: ENSMUSP00000128620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052843] [ENSMUST00000118098] [ENSMUST00000125294] [ENSMUST00000140948] [ENSMUST00000171802]
Predicted Effect probably null
Transcript: ENSMUST00000052843
AA Change: Q190*
SMART Domains Protein: ENSMUSP00000054715
Gene: ENSMUSG00000046101
AA Change: Q190*

DomainStartEndE-ValueType
Blast:MCM 101 345 1e-140 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000118098
AA Change: Q204*
SMART Domains Protein: ENSMUSP00000112851
Gene: ENSMUSG00000046101
AA Change: Q204*

DomainStartEndE-ValueType
Blast:MCM 115 358 1e-139 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000125294
AA Change: Q204*
SMART Domains Protein: ENSMUSP00000120858
Gene: ENSMUSG00000046101
AA Change: Q204*

DomainStartEndE-ValueType
Blast:MCM 115 236 3e-73 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000140948
AA Change: Q204*
SMART Domains Protein: ENSMUSP00000120577
Gene: ENSMUSG00000046101
AA Change: Q204*

DomainStartEndE-ValueType
Blast:MCM 115 358 1e-139 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000171802
AA Change: Q204*
SMART Domains Protein: ENSMUSP00000128620
Gene: ENSMUSG00000046101
AA Change: Q204*

DomainStartEndE-ValueType
Pfam:MCM 503 623 1.4e-9 PFAM
low complexity region 658 665 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency 97% (69/71)
MGI Phenotype PHENOTYPE: Homozygous knockout mice of both sexes are sterile as a result of abnormal meiosis. This in turn is caused by defective double-strand break DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A T 8: 84,167,086 Q294L probably benign Het
Aamp A G 1: 74,283,211 S95P probably damaging Het
Ankmy1 T C 1: 92,888,675 Y239C probably damaging Het
Atp12a T C 14: 56,380,055 S601P probably damaging Het
Atp1b3 T C 9: 96,343,349 T89A probably benign Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Btnl2 A T 17: 34,361,140 I216F possibly damaging Het
Cabs1 A T 5: 87,979,631 H47L probably damaging Het
Ccdc68 T A 18: 69,940,180 D66E probably benign Het
Cdc42ep4 T C 11: 113,728,566 D333G possibly damaging Het
Ckmt1 G A 2: 121,363,522 D389N possibly damaging Het
Dact1 G T 12: 71,317,575 V340F probably benign Het
Dnah2 A G 11: 69,422,754 probably null Het
Dnah2 T C 11: 69,521,198 T246A probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Efcab14 A G 4: 115,756,549 probably benign Het
Eprs A G 1: 185,401,510 T795A probably damaging Het
Esp36 T A 17: 38,417,311 E26D possibly damaging Het
Fpr-rs7 T C 17: 20,113,416 T271A probably benign Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gimap7 G A 6: 48,724,019 V180M probably damaging Het
Gm6614 C T 6: 141,980,872 S576N probably benign Het
Gtf3c1 T C 7: 125,676,661 H531R possibly damaging Het
Herc1 T A 9: 66,491,953 probably benign Het
Hip1r A G 5: 124,002,140 Y1061C probably benign Het
Ipo11 T C 13: 106,886,717 Y420C probably damaging Het
Ipo8 T C 6: 148,810,665 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Klhl1 A T 14: 96,368,636 M243K probably damaging Het
Lrp2 A G 2: 69,466,763 probably null Het
Mag T C 7: 30,901,852 E439G probably damaging Het
Mcm3ap T A 10: 76,496,541 F1231I probably benign Het
Mpl A C 4: 118,444,024 L548R probably damaging Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Myo18b G A 5: 112,875,266 Q87* probably null Het
Nfat5 A G 8: 107,293,890 Y22C probably damaging Het
Nnt T A 13: 119,386,661 I232L possibly damaging Het
Olfr12 G A 1: 92,620,745 V280M possibly damaging Het
Olfr146 T C 9: 39,018,957 N195D probably benign Het
Olfr437 A G 6: 43,167,912 N285D probably damaging Het
Parp2 C T 14: 50,810,544 P76S probably benign Het
Pick1 C T 15: 79,245,301 H169Y probably benign Het
Prtg T A 9: 72,842,807 F164L probably benign Het
Pygb A G 2: 150,817,663 D422G possibly damaging Het
Samd9l C A 6: 3,375,761 C500F probably benign Het
Sbno1 A C 5: 124,384,504 N1083K possibly damaging Het
Sept7 C T 9: 25,277,604 S77F probably damaging Het
Slc25a44 A G 3: 88,416,007 V264A possibly damaging Het
Slf2 G T 19: 44,942,073 E530* probably null Het
Svs2 A G 2: 164,237,658 S110P possibly damaging Het
Tmbim7 G T 5: 3,665,338 probably null Het
Tpgs2 T C 18: 25,140,573 D177G probably damaging Het
Uba1y T A Y: 826,893 F516L probably damaging Het
Ulk1 A G 5: 110,795,766 V211A probably damaging Het
Vmn1r237 T A 17: 21,314,039 I8N probably damaging Het
Vmn2r103 G T 17: 19,794,234 M429I probably benign Het
Vmn2r112 T C 17: 22,615,008 probably null Het
Vmn2r84 T C 10: 130,391,480 probably null Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Other mutations in Mcmdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02374:Mcmdc2 APN 1 9911982 missense possibly damaging 0.85
IGL03087:Mcmdc2 APN 1 9930945 missense possibly damaging 0.78
IGL03230:Mcmdc2 APN 1 9931996 unclassified probably benign
R0313:Mcmdc2 UTSW 1 9932141 missense probably damaging 1.00
R0448:Mcmdc2 UTSW 1 9940542 makesense probably null
R0685:Mcmdc2 UTSW 1 9911814 critical splice donor site probably null
R0926:Mcmdc2 UTSW 1 9920576 nonsense probably null
R1867:Mcmdc2 UTSW 1 9930805 missense probably damaging 1.00
R2356:Mcmdc2 UTSW 1 9930801 missense possibly damaging 0.76
R5199:Mcmdc2 UTSW 1 9920435 missense probably benign 0.37
R5341:Mcmdc2 UTSW 1 9940917 frame shift probably null
R5459:Mcmdc2 UTSW 1 9937084 missense probably benign 0.06
R5748:Mcmdc2 UTSW 1 9911807 missense probably damaging 1.00
R6808:Mcmdc2 UTSW 1 9934017 missense probably damaging 1.00
R6908:Mcmdc2 UTSW 1 9930778 splice site probably null
R7123:Mcmdc2 UTSW 1 9940418 missense unknown
R7233:Mcmdc2 UTSW 1 9932183 critical splice donor site probably null
R7498:Mcmdc2 UTSW 1 9919077 missense probably benign
R7646:Mcmdc2 UTSW 1 9912135 missense possibly damaging 0.53
R7834:Mcmdc2 UTSW 1 9912174 critical splice donor site probably null
R8118:Mcmdc2 UTSW 1 9916374 missense possibly damaging 0.68
R8194:Mcmdc2 UTSW 1 9916642 missense probably benign
R8283:Mcmdc2 UTSW 1 9934038 missense possibly damaging 0.85
R8434:Mcmdc2 UTSW 1 9920581 missense possibly damaging 0.63
R8523:Mcmdc2 UTSW 1 9911721 start codon destroyed probably null 0.87
X0025:Mcmdc2 UTSW 1 9911966 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCCTGGAGCTACAGAATCTGCAAC -3'
(R):5'- GTTCTCCACACTCACACAGTCAGTC -3'

Sequencing Primer
(F):5'- GCTACAGAATCTGCAACAGTAAG -3'
(R):5'- caacacacacacacacacac -3'
Posted On2014-04-24