Incidental Mutation 'R1590:Ankmy1'
ID177778
Institutional Source Beutler Lab
Gene Symbol Ankmy1
Ensembl Gene ENSMUSG00000034212
Gene Nameankyrin repeat and MYND domain containing 1
Synonyms4930483I10Rik
MMRRC Submission 039627-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1590 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location92859803-92902906 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92888675 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 239 (Y239C)
Ref Sequence ENSEMBL: ENSMUSP00000123787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112998] [ENSMUST00000160548]
Predicted Effect probably damaging
Transcript: ENSMUST00000112998
AA Change: Y239C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108622
Gene: ENSMUSG00000034212
AA Change: Y239C

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
MORN 87 108 4.22e0 SMART
MORN 110 131 7.05e-5 SMART
MORN 155 176 7.15e1 SMART
ANK 378 407 4.32e-5 SMART
Blast:ANK 575 604 2e-10 BLAST
ANK 607 636 2.63e2 SMART
ANK 643 675 1.87e2 SMART
ANK 719 753 1.73e-4 SMART
ANK 756 785 6.92e-4 SMART
Blast:ANK 790 828 1e-12 BLAST
low complexity region 876 889 N/A INTRINSIC
Pfam:zf-MYND 940 980 1.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160548
AA Change: Y239C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123787
Gene: ENSMUSG00000034212
AA Change: Y239C

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
MORN 87 108 4.22e0 SMART
MORN 110 131 7.05e-5 SMART
MORN 155 176 7.15e1 SMART
ANK 378 407 4.32e-5 SMART
Blast:ANK 575 604 2e-10 BLAST
ANK 607 636 2.63e2 SMART
ANK 643 675 1.87e2 SMART
ANK 719 753 1.73e-4 SMART
ANK 756 785 6.92e-4 SMART
Blast:ANK 790 828 1e-12 BLAST
low complexity region 876 889 N/A INTRINSIC
Pfam:zf-MYND 941 981 2.3e-8 PFAM
Meta Mutation Damage Score 0.5459 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency 97% (69/71)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A T 8: 84,167,086 Q294L probably benign Het
Aamp A G 1: 74,283,211 S95P probably damaging Het
Atp12a T C 14: 56,380,055 S601P probably damaging Het
Atp1b3 T C 9: 96,343,349 T89A probably benign Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Btnl2 A T 17: 34,361,140 I216F possibly damaging Het
Cabs1 A T 5: 87,979,631 H47L probably damaging Het
Ccdc68 T A 18: 69,940,180 D66E probably benign Het
Cdc42ep4 T C 11: 113,728,566 D333G possibly damaging Het
Ckmt1 G A 2: 121,363,522 D389N possibly damaging Het
Dact1 G T 12: 71,317,575 V340F probably benign Het
Dnah2 A G 11: 69,422,754 probably null Het
Dnah2 T C 11: 69,521,198 T246A probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Efcab14 A G 4: 115,756,549 probably benign Het
Eprs A G 1: 185,401,510 T795A probably damaging Het
Esp36 T A 17: 38,417,311 E26D possibly damaging Het
Fpr-rs7 T C 17: 20,113,416 T271A probably benign Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gimap7 G A 6: 48,724,019 V180M probably damaging Het
Gm6614 C T 6: 141,980,872 S576N probably benign Het
Gtf3c1 T C 7: 125,676,661 H531R possibly damaging Het
Herc1 T A 9: 66,491,953 probably benign Het
Hip1r A G 5: 124,002,140 Y1061C probably benign Het
Ipo11 T C 13: 106,886,717 Y420C probably damaging Het
Ipo8 T C 6: 148,810,665 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Klhl1 A T 14: 96,368,636 M243K probably damaging Het
Lrp2 A G 2: 69,466,763 probably null Het
Mag T C 7: 30,901,852 E439G probably damaging Het
Mcm3ap T A 10: 76,496,541 F1231I probably benign Het
Mcmdc2 C T 1: 9,916,555 Q204* probably null Het
Mpl A C 4: 118,444,024 L548R probably damaging Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Myo18b G A 5: 112,875,266 Q87* probably null Het
Nfat5 A G 8: 107,293,890 Y22C probably damaging Het
Nnt T A 13: 119,386,661 I232L possibly damaging Het
Olfr12 G A 1: 92,620,745 V280M possibly damaging Het
Olfr146 T C 9: 39,018,957 N195D probably benign Het
Olfr437 A G 6: 43,167,912 N285D probably damaging Het
Parp2 C T 14: 50,810,544 P76S probably benign Het
Pick1 C T 15: 79,245,301 H169Y probably benign Het
Prtg T A 9: 72,842,807 F164L probably benign Het
Pygb A G 2: 150,817,663 D422G possibly damaging Het
Samd9l C A 6: 3,375,761 C500F probably benign Het
Sbno1 A C 5: 124,384,504 N1083K possibly damaging Het
Sept7 C T 9: 25,277,604 S77F probably damaging Het
Slc25a44 A G 3: 88,416,007 V264A possibly damaging Het
Slf2 G T 19: 44,942,073 E530* probably null Het
Svs2 A G 2: 164,237,658 S110P possibly damaging Het
Tmbim7 G T 5: 3,665,338 probably null Het
Tpgs2 T C 18: 25,140,573 D177G probably damaging Het
Uba1y T A Y: 826,893 F516L probably damaging Het
Ulk1 A G 5: 110,795,766 V211A probably damaging Het
Vmn1r237 T A 17: 21,314,039 I8N probably damaging Het
Vmn2r103 G T 17: 19,794,234 M429I probably benign Het
Vmn2r112 T C 17: 22,615,008 probably null Het
Vmn2r84 T C 10: 130,391,480 probably null Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Other mutations in Ankmy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Ankmy1 APN 1 92886266 missense probably damaging 1.00
IGL01061:Ankmy1 APN 1 92870974 splice site probably benign
IGL01960:Ankmy1 APN 1 92871663 splice site probably benign
IGL01984:Ankmy1 APN 1 92883765 missense probably damaging 0.99
IGL02193:Ankmy1 APN 1 92881045 missense probably benign 0.03
IGL02536:Ankmy1 APN 1 92886188 missense probably damaging 1.00
IGL02644:Ankmy1 APN 1 92885054 missense probably benign 0.18
IGL02650:Ankmy1 APN 1 92881023 missense probably damaging 1.00
IGL02660:Ankmy1 APN 1 92896094 missense probably damaging 1.00
IGL02808:Ankmy1 APN 1 92886666 missense probably damaging 1.00
PIT4687001:Ankmy1 UTSW 1 92885081 missense probably benign 0.00
R0313:Ankmy1 UTSW 1 92886221 missense probably damaging 1.00
R0373:Ankmy1 UTSW 1 92896190 missense probably damaging 0.99
R0383:Ankmy1 UTSW 1 92885053 missense probably benign 0.00
R0499:Ankmy1 UTSW 1 92886226 missense probably damaging 1.00
R0562:Ankmy1 UTSW 1 92899691 splice site probably benign
R0607:Ankmy1 UTSW 1 92888675 missense probably damaging 1.00
R0739:Ankmy1 UTSW 1 92888648 missense probably damaging 1.00
R0962:Ankmy1 UTSW 1 92899568 nonsense probably null
R1192:Ankmy1 UTSW 1 92883894 missense probably damaging 0.99
R1491:Ankmy1 UTSW 1 92886809 missense probably benign 0.02
R1568:Ankmy1 UTSW 1 92881116 missense probably damaging 1.00
R1585:Ankmy1 UTSW 1 92899651 missense probably benign 0.00
R1664:Ankmy1 UTSW 1 92885191 missense probably benign 0.00
R1714:Ankmy1 UTSW 1 92885194 nonsense probably null
R1818:Ankmy1 UTSW 1 92886831 missense probably benign 0.43
R2014:Ankmy1 UTSW 1 92885141 missense probably benign 0.00
R2043:Ankmy1 UTSW 1 92876527 unclassified probably benign
R2056:Ankmy1 UTSW 1 92881831 missense possibly damaging 0.61
R2427:Ankmy1 UTSW 1 92870807 critical splice donor site probably null
R3806:Ankmy1 UTSW 1 92883758 missense possibly damaging 0.92
R3883:Ankmy1 UTSW 1 92886152 missense probably damaging 1.00
R3884:Ankmy1 UTSW 1 92886152 missense probably damaging 1.00
R4118:Ankmy1 UTSW 1 92888696 missense possibly damaging 0.60
R4132:Ankmy1 UTSW 1 92885100 missense probably benign
R4441:Ankmy1 UTSW 1 92888661 missense possibly damaging 0.92
R4543:Ankmy1 UTSW 1 92884850 missense probably damaging 1.00
R4602:Ankmy1 UTSW 1 92888650 missense probably benign 0.38
R4779:Ankmy1 UTSW 1 92886723 missense probably benign 0.23
R5200:Ankmy1 UTSW 1 92870292 missense probably benign 0.00
R5381:Ankmy1 UTSW 1 92876562 missense probably benign
R5425:Ankmy1 UTSW 1 92870957 nonsense probably null
R5474:Ankmy1 UTSW 1 92885204 missense possibly damaging 0.59
R5534:Ankmy1 UTSW 1 92886720 missense probably damaging 1.00
R5607:Ankmy1 UTSW 1 92877018 missense probably damaging 1.00
R6112:Ankmy1 UTSW 1 92870962 missense probably damaging 1.00
R6117:Ankmy1 UTSW 1 92861274 unclassified probably benign
R6376:Ankmy1 UTSW 1 92888465 missense possibly damaging 0.60
R6712:Ankmy1 UTSW 1 92870922 missense probably damaging 1.00
R6915:Ankmy1 UTSW 1 92888451 missense probably null 1.00
R7201:Ankmy1 UTSW 1 92886824 missense possibly damaging 0.95
R7432:Ankmy1 UTSW 1 92896079 missense probably benign
R7485:Ankmy1 UTSW 1 92876657 missense probably damaging 0.99
R7795:Ankmy1 UTSW 1 92883848 missense probably benign
R7851:Ankmy1 UTSW 1 92871722 missense probably damaging 1.00
R8018:Ankmy1 UTSW 1 92886281 missense probably benign 0.02
R8024:Ankmy1 UTSW 1 92884994 missense probably benign
R8276:Ankmy1 UTSW 1 92886809 missense probably benign 0.02
R8373:Ankmy1 UTSW 1 92896094 missense probably damaging 0.98
Z1176:Ankmy1 UTSW 1 92878437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGTTCTTCGTCCTCAATGAACG -3'
(R):5'- ACCTGGTAGAAAGCCTGACTGAGTG -3'

Sequencing Primer
(F):5'- TCGGTCGAATAGACGTGCAT -3'
(R):5'- ATCGAGACCTACCCTGATGG -3'
Posted On2014-04-24