Incidental Mutation 'R1590:Fsip2'
ID 177783
Institutional Source Beutler Lab
Gene Symbol Fsip2
Ensembl Gene ENSMUSG00000075249
Gene Name fibrous sheath-interacting protein 2
Synonyms OTTMUSG00000013335
MMRRC Submission 039627-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R1590 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 82773978-82839281 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 82813131 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 3150 (H3150L)
Ref Sequence ENSEMBL: ENSMUSP00000120314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143764]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000122350
Gene: ENSMUSG00000075249
AA Change: H664L

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 381 392 N/A INTRINSIC
low complexity region 411 430 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
low complexity region 953 962 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143764
AA Change: H3150L

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120314
Gene: ENSMUSG00000075249
AA Change: H3150L

DomainStartEndE-ValueType
coiled coil region 271 297 N/A INTRINSIC
low complexity region 544 561 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1115 1120 N/A INTRINSIC
low complexity region 1531 1545 N/A INTRINSIC
low complexity region 2044 2057 N/A INTRINSIC
low complexity region 2507 2523 N/A INTRINSIC
low complexity region 2564 2575 N/A INTRINSIC
low complexity region 2866 2877 N/A INTRINSIC
low complexity region 2896 2915 N/A INTRINSIC
low complexity region 3220 3231 N/A INTRINSIC
low complexity region 3438 3447 N/A INTRINSIC
Pfam:FSIP2 4045 4408 3.5e-42 PFAM
Pfam:FSIP2 4375 4613 7.7e-26 PFAM
Pfam:FSIP2 4622 4932 4.3e-17 PFAM
Pfam:FSIP2 4903 5454 7e-27 PFAM
low complexity region 5507 5522 N/A INTRINSIC
low complexity region 5769 5780 N/A INTRINSIC
low complexity region 5834 5846 N/A INTRINSIC
low complexity region 5851 5867 N/A INTRINSIC
Pfam:FSIP2 5998 6867 N/A PFAM
low complexity region 6977 6990 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the sperm fibrous sheath. Genes encoding most of the fibrous-sheath associated proteins genes are transcribed only during the postmeiotic period of spermatogenesis. The protein encoded by this gene is specific to spermatogenic cells. Copy number variation in this gene may be associated with testicular germ cell tumors. Pseudogenes associated with this gene are reported on chromosomes 2 and X. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,322,370 (GRCm39) S95P probably damaging Het
Ankmy1 T C 1: 92,816,397 (GRCm39) Y239C probably damaging Het
Atp12a T C 14: 56,617,512 (GRCm39) S601P probably damaging Het
Atp1b3 T C 9: 96,225,402 (GRCm39) T89A probably benign Het
B3galt4 G A 17: 34,169,813 (GRCm39) R142C probably damaging Het
Brme1 A T 8: 84,893,715 (GRCm39) Q294L probably benign Het
Btnl2 A T 17: 34,580,114 (GRCm39) I216F possibly damaging Het
Cabs1 A T 5: 88,127,490 (GRCm39) H47L probably damaging Het
Ccdc68 T A 18: 70,073,251 (GRCm39) D66E probably benign Het
Cdc42ep4 T C 11: 113,619,392 (GRCm39) D333G possibly damaging Het
Ckmt1 G A 2: 121,194,003 (GRCm39) D389N possibly damaging Het
Dact1 G T 12: 71,364,349 (GRCm39) V340F probably benign Het
Dnah2 T C 11: 69,412,024 (GRCm39) T246A probably benign Het
Dnah2 A G 11: 69,313,580 (GRCm39) probably null Het
Ecm1 G A 3: 95,643,275 (GRCm39) R342C probably damaging Het
Efcab14 A G 4: 115,613,746 (GRCm39) probably benign Het
Eprs1 A G 1: 185,133,707 (GRCm39) T795A probably damaging Het
Esp36 T A 17: 38,728,202 (GRCm39) E26D possibly damaging Het
Fpr-rs7 T C 17: 20,333,678 (GRCm39) T271A probably benign Het
Gimap7 G A 6: 48,700,953 (GRCm39) V180M probably damaging Het
Gtf3c1 T C 7: 125,275,833 (GRCm39) H531R possibly damaging Het
Herc1 T A 9: 66,399,235 (GRCm39) probably benign Het
Hip1r A G 5: 124,140,203 (GRCm39) Y1061C probably benign Het
Ipo11 T C 13: 107,023,225 (GRCm39) Y420C probably damaging Het
Ipo8 T C 6: 148,712,163 (GRCm39) probably null Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Klhl1 A T 14: 96,606,072 (GRCm39) M243K probably damaging Het
Lrp2 A G 2: 69,297,107 (GRCm39) probably null Het
Mag T C 7: 30,601,277 (GRCm39) E439G probably damaging Het
Mcm3ap T A 10: 76,332,375 (GRCm39) F1231I probably benign Het
Mcmdc2 C T 1: 9,986,780 (GRCm39) Q204* probably null Het
Mpl A C 4: 118,301,221 (GRCm39) L548R probably damaging Het
Mrps2 C T 2: 28,359,500 (GRCm39) A119V probably benign Het
Myo18b G A 5: 113,023,132 (GRCm39) Q87* probably null Het
Nfat5 A G 8: 108,020,522 (GRCm39) Y22C probably damaging Het
Nnt T A 13: 119,523,197 (GRCm39) I232L possibly damaging Het
Or2a52 A G 6: 43,144,846 (GRCm39) N285D probably damaging Het
Or8g17 T C 9: 38,930,253 (GRCm39) N195D probably benign Het
Or9s13 G A 1: 92,548,467 (GRCm39) V280M possibly damaging Het
Parp2 C T 14: 51,048,001 (GRCm39) P76S probably benign Het
Pick1 C T 15: 79,129,501 (GRCm39) H169Y probably benign Het
Prtg T A 9: 72,750,089 (GRCm39) F164L probably benign Het
Pygb A G 2: 150,659,583 (GRCm39) D422G possibly damaging Het
Samd9l C A 6: 3,375,761 (GRCm39) C500F probably benign Het
Sbno1 A C 5: 124,522,567 (GRCm39) N1083K possibly damaging Het
Septin7 C T 9: 25,188,900 (GRCm39) S77F probably damaging Het
Slc25a44 A G 3: 88,323,314 (GRCm39) V264A possibly damaging Het
Slco1a8 C T 6: 141,926,598 (GRCm39) S576N probably benign Het
Slf2 G T 19: 44,930,512 (GRCm39) E530* probably null Het
Svs5 A G 2: 164,079,578 (GRCm39) S110P possibly damaging Het
Tmbim7 G T 5: 3,715,338 (GRCm39) probably null Het
Tpgs2 T C 18: 25,273,630 (GRCm39) D177G probably damaging Het
Uba1y T A Y: 826,893 (GRCm39) F516L probably damaging Het
Ulk1 A G 5: 110,943,632 (GRCm39) V211A probably damaging Het
Vmn1r237 T A 17: 21,534,301 (GRCm39) I8N probably damaging Het
Vmn2r103 G T 17: 20,014,496 (GRCm39) M429I probably benign Het
Vmn2r112 T C 17: 22,833,989 (GRCm39) probably null Het
Vmn2r84 T C 10: 130,227,349 (GRCm39) probably null Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Other mutations in Fsip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Fsip2 APN 2 82,820,730 (GRCm39) missense probably benign 0.18
IGL00557:Fsip2 APN 2 82,821,657 (GRCm39) missense possibly damaging 0.53
IGL01343:Fsip2 APN 2 82,830,163 (GRCm39) missense possibly damaging 0.53
IGL01387:Fsip2 APN 2 82,823,326 (GRCm39) missense possibly damaging 0.71
IGL01523:Fsip2 APN 2 82,807,863 (GRCm39) missense probably benign
IGL01554:Fsip2 APN 2 82,807,622 (GRCm39) missense possibly damaging 0.68
IGL01650:Fsip2 APN 2 82,821,430 (GRCm39) missense probably benign 0.33
IGL01809:Fsip2 APN 2 82,808,691 (GRCm39) missense possibly damaging 0.80
IGL01826:Fsip2 APN 2 82,812,983 (GRCm39) missense probably benign 0.18
IGL01830:Fsip2 APN 2 82,815,273 (GRCm39) missense probably benign
IGL01918:Fsip2 APN 2 82,822,482 (GRCm39) missense possibly damaging 0.71
IGL01932:Fsip2 APN 2 82,824,349 (GRCm39) missense possibly damaging 0.71
IGL01989:Fsip2 APN 2 82,824,211 (GRCm39) missense probably damaging 0.99
IGL02096:Fsip2 APN 2 82,822,204 (GRCm39) missense possibly damaging 0.85
IGL02153:Fsip2 APN 2 82,809,065 (GRCm39) missense probably benign
IGL02155:Fsip2 APN 2 82,828,696 (GRCm39) missense probably benign
IGL02219:Fsip2 APN 2 82,808,174 (GRCm39) missense probably benign 0.07
IGL02248:Fsip2 APN 2 82,813,116 (GRCm39) missense possibly damaging 0.73
IGL02316:Fsip2 APN 2 82,809,137 (GRCm39) missense probably benign
IGL02478:Fsip2 APN 2 82,814,736 (GRCm39) missense probably benign 0.00
IGL02504:Fsip2 APN 2 82,809,199 (GRCm39) missense possibly damaging 0.83
IGL02572:Fsip2 APN 2 82,822,347 (GRCm39) missense probably benign 0.32
IGL02625:Fsip2 APN 2 82,779,836 (GRCm39) missense probably benign 0.00
IGL02665:Fsip2 APN 2 82,823,407 (GRCm39) missense probably damaging 1.00
IGL02668:Fsip2 APN 2 82,828,662 (GRCm39) missense probably benign 0.06
IGL02676:Fsip2 APN 2 82,812,501 (GRCm39) missense possibly damaging 0.53
IGL02717:Fsip2 APN 2 82,781,370 (GRCm39) splice site probably benign
IGL02805:Fsip2 APN 2 82,823,839 (GRCm39) missense probably benign 0.01
IGL02943:Fsip2 APN 2 82,822,701 (GRCm39) missense probably benign 0.32
IGL02965:Fsip2 APN 2 82,813,398 (GRCm39) missense probably benign 0.33
IGL03001:Fsip2 APN 2 82,820,968 (GRCm39) intron probably benign
IGL03076:Fsip2 APN 2 82,812,482 (GRCm39) missense possibly damaging 0.96
IGL03229:Fsip2 APN 2 82,808,420 (GRCm39) missense possibly damaging 0.86
IGL03353:Fsip2 APN 2 82,807,737 (GRCm39) missense possibly damaging 0.85
IGL03401:Fsip2 APN 2 82,820,814 (GRCm39) missense probably benign
bubblegum UTSW 2 82,823,184 (GRCm39) missense probably benign 0.16
Dao UTSW 2 82,823,494 (GRCm39) missense probably damaging 0.97
engulf UTSW 2 82,815,120 (GRCm39) missense probably damaging 0.98
envelope UTSW 2 82,811,085 (GRCm39) missense probably benign 0.07
gladius UTSW 2 82,812,293 (GRCm39) missense possibly damaging 0.68
glove UTSW 2 82,808,738 (GRCm39) missense possibly damaging 0.85
Katana UTSW 2 82,819,860 (GRCm39) missense probably benign 0.07
scarf UTSW 2 82,817,235 (GRCm39) missense probably benign
Sock UTSW 2 82,828,524 (GRCm39) missense probably benign 0.00
swaddle UTSW 2 82,813,772 (GRCm39) missense possibly damaging 0.93
wrap UTSW 2 82,817,164 (GRCm39) missense probably benign 0.04
Wrapper UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
D4186:Fsip2 UTSW 2 82,818,756 (GRCm39) missense probably benign 0.32
FR4976:Fsip2 UTSW 2 82,814,709 (GRCm39) critical splice acceptor site probably benign
FR4976:Fsip2 UTSW 2 82,814,706 (GRCm39) critical splice acceptor site probably benign
PIT4382001:Fsip2 UTSW 2 82,821,196 (GRCm39) missense possibly damaging 0.86
R0017:Fsip2 UTSW 2 82,822,416 (GRCm39) missense probably damaging 0.98
R0017:Fsip2 UTSW 2 82,822,416 (GRCm39) missense probably damaging 0.98
R0021:Fsip2 UTSW 2 82,830,201 (GRCm39) splice site probably benign
R0054:Fsip2 UTSW 2 82,817,299 (GRCm39) missense possibly damaging 0.85
R0054:Fsip2 UTSW 2 82,817,299 (GRCm39) missense possibly damaging 0.85
R0054:Fsip2 UTSW 2 82,806,952 (GRCm39) missense probably damaging 0.96
R0104:Fsip2 UTSW 2 82,809,317 (GRCm39) missense possibly damaging 0.91
R0104:Fsip2 UTSW 2 82,809,317 (GRCm39) missense possibly damaging 0.91
R0127:Fsip2 UTSW 2 82,815,269 (GRCm39) missense probably benign 0.28
R0131:Fsip2 UTSW 2 82,821,465 (GRCm39) missense probably benign
R0149:Fsip2 UTSW 2 82,805,849 (GRCm39) missense possibly damaging 0.93
R0167:Fsip2 UTSW 2 82,811,151 (GRCm39) missense possibly damaging 0.53
R0190:Fsip2 UTSW 2 82,815,521 (GRCm39) missense possibly damaging 0.73
R0323:Fsip2 UTSW 2 82,816,240 (GRCm39) missense probably benign 0.33
R0358:Fsip2 UTSW 2 82,813,677 (GRCm39) missense possibly damaging 0.56
R0361:Fsip2 UTSW 2 82,805,849 (GRCm39) missense possibly damaging 0.93
R0369:Fsip2 UTSW 2 82,814,908 (GRCm39) missense probably benign 0.33
R0394:Fsip2 UTSW 2 82,821,419 (GRCm39) missense possibly damaging 0.70
R0532:Fsip2 UTSW 2 82,808,129 (GRCm39) missense probably benign 0.33
R0595:Fsip2 UTSW 2 82,777,296 (GRCm39) missense probably damaging 0.99
R0613:Fsip2 UTSW 2 82,824,139 (GRCm39) missense probably damaging 0.99
R0614:Fsip2 UTSW 2 82,807,877 (GRCm39) missense probably benign 0.15
R0619:Fsip2 UTSW 2 82,774,484 (GRCm39) missense probably damaging 1.00
R0626:Fsip2 UTSW 2 82,819,302 (GRCm39) missense probably benign 0.06
R0644:Fsip2 UTSW 2 82,807,241 (GRCm39) missense probably benign 0.02
R0661:Fsip2 UTSW 2 82,816,513 (GRCm39) missense possibly damaging 0.92
R0680:Fsip2 UTSW 2 82,821,703 (GRCm39) missense possibly damaging 0.73
R0688:Fsip2 UTSW 2 82,812,683 (GRCm39) missense probably benign 0.18
R0881:Fsip2 UTSW 2 82,816,617 (GRCm39) missense possibly damaging 0.52
R0919:Fsip2 UTSW 2 82,815,828 (GRCm39) missense possibly damaging 0.53
R0973:Fsip2 UTSW 2 82,807,436 (GRCm39) missense probably benign 0.05
R0973:Fsip2 UTSW 2 82,807,436 (GRCm39) missense probably benign 0.05
R0974:Fsip2 UTSW 2 82,807,436 (GRCm39) missense probably benign 0.05
R0976:Fsip2 UTSW 2 82,828,375 (GRCm39) missense possibly damaging 0.92
R1025:Fsip2 UTSW 2 82,819,780 (GRCm39) nonsense probably null
R1026:Fsip2 UTSW 2 82,818,805 (GRCm39) missense possibly damaging 0.52
R1140:Fsip2 UTSW 2 82,805,378 (GRCm39) missense probably damaging 0.99
R1170:Fsip2 UTSW 2 82,821,844 (GRCm39) missense possibly damaging 0.72
R1180:Fsip2 UTSW 2 82,805,570 (GRCm39) missense probably damaging 0.99
R1188:Fsip2 UTSW 2 82,805,361 (GRCm39) missense possibly damaging 0.96
R1226:Fsip2 UTSW 2 82,811,355 (GRCm39) missense probably damaging 0.96
R1248:Fsip2 UTSW 2 82,820,107 (GRCm39) missense possibly damaging 0.93
R1273:Fsip2 UTSW 2 82,819,752 (GRCm39) missense possibly damaging 0.92
R1323:Fsip2 UTSW 2 82,816,096 (GRCm39) missense probably damaging 1.00
R1323:Fsip2 UTSW 2 82,816,096 (GRCm39) missense probably damaging 1.00
R1356:Fsip2 UTSW 2 82,820,089 (GRCm39) missense probably benign 0.38
R1413:Fsip2 UTSW 2 82,818,762 (GRCm39) missense possibly damaging 0.93
R1430:Fsip2 UTSW 2 82,828,407 (GRCm39) missense possibly damaging 0.71
R1475:Fsip2 UTSW 2 82,817,539 (GRCm39) missense probably damaging 0.99
R1489:Fsip2 UTSW 2 82,810,155 (GRCm39) missense probably benign
R1520:Fsip2 UTSW 2 82,811,058 (GRCm39) missense possibly damaging 0.96
R1543:Fsip2 UTSW 2 82,811,931 (GRCm39) missense possibly damaging 0.91
R1581:Fsip2 UTSW 2 82,816,626 (GRCm39) missense probably damaging 0.98
R1646:Fsip2 UTSW 2 82,808,861 (GRCm39) missense probably benign 0.07
R1678:Fsip2 UTSW 2 82,816,689 (GRCm39) missense probably benign
R1700:Fsip2 UTSW 2 82,822,081 (GRCm39) missense probably benign 0.33
R1717:Fsip2 UTSW 2 82,805,289 (GRCm39) missense possibly damaging 0.68
R1741:Fsip2 UTSW 2 82,820,256 (GRCm39) missense probably benign 0.32
R1760:Fsip2 UTSW 2 82,818,055 (GRCm39) missense possibly damaging 0.71
R1760:Fsip2 UTSW 2 82,815,240 (GRCm39) missense probably benign 0.07
R1760:Fsip2 UTSW 2 82,830,185 (GRCm39) missense possibly damaging 0.85
R1789:Fsip2 UTSW 2 82,807,906 (GRCm39) missense probably benign 0.00
R1850:Fsip2 UTSW 2 82,814,933 (GRCm39) missense possibly damaging 0.72
R1854:Fsip2 UTSW 2 82,823,601 (GRCm39) missense possibly damaging 0.84
R1888:Fsip2 UTSW 2 82,774,504 (GRCm39) missense probably benign 0.04
R1888:Fsip2 UTSW 2 82,774,504 (GRCm39) missense probably benign 0.04
R1905:Fsip2 UTSW 2 82,813,772 (GRCm39) missense possibly damaging 0.93
R1907:Fsip2 UTSW 2 82,813,772 (GRCm39) missense possibly damaging 0.93
R1920:Fsip2 UTSW 2 82,817,164 (GRCm39) missense probably benign 0.04
R1921:Fsip2 UTSW 2 82,811,127 (GRCm39) nonsense probably null
R1921:Fsip2 UTSW 2 82,817,164 (GRCm39) missense probably benign 0.04
R1931:Fsip2 UTSW 2 82,817,077 (GRCm39) missense probably damaging 0.99
R1934:Fsip2 UTSW 2 82,810,902 (GRCm39) missense possibly damaging 0.91
R1959:Fsip2 UTSW 2 82,821,894 (GRCm39) missense probably benign
R1965:Fsip2 UTSW 2 82,823,124 (GRCm39) missense possibly damaging 0.86
R1966:Fsip2 UTSW 2 82,823,124 (GRCm39) missense possibly damaging 0.86
R1983:Fsip2 UTSW 2 82,810,175 (GRCm39) missense probably benign
R1988:Fsip2 UTSW 2 82,806,861 (GRCm39) missense possibly damaging 0.56
R2016:Fsip2 UTSW 2 82,813,076 (GRCm39) missense possibly damaging 0.53
R2017:Fsip2 UTSW 2 82,813,076 (GRCm39) missense possibly damaging 0.53
R2026:Fsip2 UTSW 2 82,819,788 (GRCm39) missense possibly damaging 0.71
R2034:Fsip2 UTSW 2 82,819,838 (GRCm39) missense probably benign 0.43
R2037:Fsip2 UTSW 2 82,808,856 (GRCm39) missense probably damaging 0.99
R2070:Fsip2 UTSW 2 82,806,699 (GRCm39) missense probably damaging 0.98
R2072:Fsip2 UTSW 2 82,839,159 (GRCm39) missense possibly damaging 0.53
R2075:Fsip2 UTSW 2 82,818,923 (GRCm39) missense possibly damaging 0.85
R2143:Fsip2 UTSW 2 82,820,615 (GRCm39) missense possibly damaging 0.93
R2207:Fsip2 UTSW 2 82,807,823 (GRCm39) missense probably benign 0.02
R2256:Fsip2 UTSW 2 82,793,095 (GRCm39) missense probably benign 0.07
R2315:Fsip2 UTSW 2 82,805,437 (GRCm39) missense probably benign
R2344:Fsip2 UTSW 2 82,820,257 (GRCm39) missense possibly damaging 0.71
R2377:Fsip2 UTSW 2 82,806,593 (GRCm39) missense probably benign 0.29
R2403:Fsip2 UTSW 2 82,811,064 (GRCm39) missense possibly damaging 0.53
R2441:Fsip2 UTSW 2 82,815,685 (GRCm39) missense possibly damaging 0.53
R2504:Fsip2 UTSW 2 82,809,954 (GRCm39) missense possibly damaging 0.86
R2510:Fsip2 UTSW 2 82,816,782 (GRCm39) missense probably benign
R2511:Fsip2 UTSW 2 82,816,782 (GRCm39) missense probably benign
R2511:Fsip2 UTSW 2 82,782,001 (GRCm39) missense probably damaging 1.00
R2512:Fsip2 UTSW 2 82,808,511 (GRCm39) missense probably benign 0.04
R2568:Fsip2 UTSW 2 82,820,775 (GRCm39) missense probably benign 0.14
R2656:Fsip2 UTSW 2 82,809,389 (GRCm39) missense possibly damaging 0.83
R2883:Fsip2 UTSW 2 82,821,868 (GRCm39) missense possibly damaging 0.86
R3417:Fsip2 UTSW 2 82,816,854 (GRCm39) missense possibly damaging 0.51
R3431:Fsip2 UTSW 2 82,822,354 (GRCm39) missense possibly damaging 0.85
R3441:Fsip2 UTSW 2 82,817,071 (GRCm39) missense probably benign 0.00
R3605:Fsip2 UTSW 2 82,815,253 (GRCm39) missense probably benign 0.28
R3620:Fsip2 UTSW 2 82,810,602 (GRCm39) missense probably benign 0.00
R3621:Fsip2 UTSW 2 82,810,602 (GRCm39) missense probably benign 0.00
R3726:Fsip2 UTSW 2 82,819,311 (GRCm39) missense possibly damaging 0.84
R3755:Fsip2 UTSW 2 82,808,561 (GRCm39) missense probably benign 0.26
R3789:Fsip2 UTSW 2 82,813,058 (GRCm39) missense probably damaging 0.96
R3836:Fsip2 UTSW 2 82,781,290 (GRCm39) missense probably damaging 1.00
R3844:Fsip2 UTSW 2 82,819,950 (GRCm39) missense possibly damaging 0.52
R3846:Fsip2 UTSW 2 82,816,759 (GRCm39) missense possibly damaging 0.52
R3861:Fsip2 UTSW 2 82,815,120 (GRCm39) missense probably damaging 0.98
R3981:Fsip2 UTSW 2 82,789,006 (GRCm39) missense probably benign 0.08
R4014:Fsip2 UTSW 2 82,813,862 (GRCm39) missense probably benign
R4042:Fsip2 UTSW 2 82,813,896 (GRCm39) missense probably benign 0.02
R4075:Fsip2 UTSW 2 82,813,245 (GRCm39) missense probably benign 0.26
R4154:Fsip2 UTSW 2 82,817,413 (GRCm39) missense possibly damaging 0.71
R4210:Fsip2 UTSW 2 82,805,493 (GRCm39) missense probably damaging 0.99
R4211:Fsip2 UTSW 2 82,805,493 (GRCm39) missense probably damaging 0.99
R4327:Fsip2 UTSW 2 82,817,403 (GRCm39) missense probably benign 0.25
R4332:Fsip2 UTSW 2 82,808,201 (GRCm39) missense probably benign 0.00
R4440:Fsip2 UTSW 2 82,821,550 (GRCm39) missense possibly damaging 0.85
R4454:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4455:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4457:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4458:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4540:Fsip2 UTSW 2 82,782,009 (GRCm39) missense probably benign
R4549:Fsip2 UTSW 2 82,819,972 (GRCm39) missense probably damaging 0.99
R4558:Fsip2 UTSW 2 82,815,297 (GRCm39) missense possibly damaging 0.73
R4573:Fsip2 UTSW 2 82,816,510 (GRCm39) missense possibly damaging 0.71
R4583:Fsip2 UTSW 2 82,809,017 (GRCm39) missense probably benign 0.33
R4618:Fsip2 UTSW 2 82,818,103 (GRCm39) missense probably benign
R4700:Fsip2 UTSW 2 82,817,373 (GRCm39) missense probably benign 0.32
R4716:Fsip2 UTSW 2 82,805,203 (GRCm39) missense probably damaging 0.96
R4739:Fsip2 UTSW 2 82,805,697 (GRCm39) missense possibly damaging 0.92
R4749:Fsip2 UTSW 2 82,819,629 (GRCm39) missense probably benign 0.06
R4791:Fsip2 UTSW 2 82,812,452 (GRCm39) missense possibly damaging 0.53
R4793:Fsip2 UTSW 2 82,818,044 (GRCm39) nonsense probably null
R4819:Fsip2 UTSW 2 82,818,786 (GRCm39) missense probably benign 0.06
R4832:Fsip2 UTSW 2 82,820,515 (GRCm39) missense possibly damaging 0.92
R4840:Fsip2 UTSW 2 82,815,815 (GRCm39) missense probably benign 0.26
R4840:Fsip2 UTSW 2 82,779,739 (GRCm39) missense probably benign 0.01
R4865:Fsip2 UTSW 2 82,821,295 (GRCm39) missense possibly damaging 0.86
R4876:Fsip2 UTSW 2 82,805,202 (GRCm39) missense possibly damaging 0.91
R4885:Fsip2 UTSW 2 82,818,438 (GRCm39) missense probably benign 0.02
R4911:Fsip2 UTSW 2 82,811,837 (GRCm39) missense possibly damaging 0.85
R4918:Fsip2 UTSW 2 82,824,114 (GRCm39) missense possibly damaging 0.51
R4936:Fsip2 UTSW 2 82,815,384 (GRCm39) missense probably benign 0.18
R4950:Fsip2 UTSW 2 82,807,758 (GRCm39) missense probably benign 0.03
R4950:Fsip2 UTSW 2 82,777,276 (GRCm39) missense probably damaging 0.97
R4959:Fsip2 UTSW 2 82,815,169 (GRCm39) missense probably benign 0.00
R4971:Fsip2 UTSW 2 82,816,222 (GRCm39) missense probably benign 0.38
R4973:Fsip2 UTSW 2 82,815,169 (GRCm39) missense probably benign 0.00
R4976:Fsip2 UTSW 2 82,818,535 (GRCm39) missense probably damaging 0.99
R5022:Fsip2 UTSW 2 82,809,773 (GRCm39) missense probably benign 0.33
R5027:Fsip2 UTSW 2 82,819,477 (GRCm39) missense possibly damaging 0.71
R5030:Fsip2 UTSW 2 82,818,836 (GRCm39) missense possibly damaging 0.85
R5048:Fsip2 UTSW 2 82,823,494 (GRCm39) missense probably damaging 0.97
R5096:Fsip2 UTSW 2 82,821,460 (GRCm39) missense probably benign 0.00
R5097:Fsip2 UTSW 2 82,822,329 (GRCm39) missense probably benign
R5119:Fsip2 UTSW 2 82,818,535 (GRCm39) missense probably damaging 0.99
R5138:Fsip2 UTSW 2 82,811,768 (GRCm39) missense probably benign 0.12
R5152:Fsip2 UTSW 2 82,808,916 (GRCm39) missense probably benign 0.43
R5174:Fsip2 UTSW 2 82,811,085 (GRCm39) missense probably benign 0.07
R5193:Fsip2 UTSW 2 82,813,338 (GRCm39) missense possibly damaging 0.53
R5245:Fsip2 UTSW 2 82,823,505 (GRCm39) missense probably benign 0.02
R5282:Fsip2 UTSW 2 82,808,925 (GRCm39) missense possibly damaging 0.61
R5323:Fsip2 UTSW 2 82,818,489 (GRCm39) missense possibly damaging 0.71
R5326:Fsip2 UTSW 2 82,812,207 (GRCm39) missense possibly damaging 0.84
R5378:Fsip2 UTSW 2 82,820,185 (GRCm39) missense possibly damaging 0.71
R5380:Fsip2 UTSW 2 82,805,742 (GRCm39) missense possibly damaging 0.91
R5396:Fsip2 UTSW 2 82,821,262 (GRCm39) missense probably benign 0.00
R5422:Fsip2 UTSW 2 82,812,572 (GRCm39) missense probably benign 0.00
R5481:Fsip2 UTSW 2 82,810,230 (GRCm39) missense probably benign 0.26
R5482:Fsip2 UTSW 2 82,815,654 (GRCm39) missense possibly damaging 0.80
R5513:Fsip2 UTSW 2 82,815,542 (GRCm39) missense possibly damaging 0.72
R5513:Fsip2 UTSW 2 82,781,256 (GRCm39) missense probably benign 0.07
R5513:Fsip2 UTSW 2 82,781,252 (GRCm39) missense probably damaging 1.00
R5536:Fsip2 UTSW 2 82,817,403 (GRCm39) missense probably benign 0.25
R5542:Fsip2 UTSW 2 82,812,207 (GRCm39) missense possibly damaging 0.84
R5553:Fsip2 UTSW 2 82,793,090 (GRCm39) missense probably benign
R5568:Fsip2 UTSW 2 82,816,908 (GRCm39) missense probably benign 0.25
R5581:Fsip2 UTSW 2 82,828,472 (GRCm39) missense possibly damaging 0.84
R5664:Fsip2 UTSW 2 82,818,439 (GRCm39) missense probably benign 0.05
R5672:Fsip2 UTSW 2 82,817,838 (GRCm39) nonsense probably null
R5712:Fsip2 UTSW 2 82,839,192 (GRCm39) missense possibly damaging 0.73
R5762:Fsip2 UTSW 2 82,808,260 (GRCm39) missense probably benign 0.33
R5772:Fsip2 UTSW 2 82,815,084 (GRCm39) missense probably benign
R5881:Fsip2 UTSW 2 82,814,785 (GRCm39) missense possibly damaging 0.72
R5919:Fsip2 UTSW 2 82,822,953 (GRCm39) missense possibly damaging 0.71
R5920:Fsip2 UTSW 2 82,818,852 (GRCm39) nonsense probably null
R5934:Fsip2 UTSW 2 82,817,092 (GRCm39) missense possibly damaging 0.86
R5938:Fsip2 UTSW 2 82,807,835 (GRCm39) missense probably benign 0.00
R5974:Fsip2 UTSW 2 82,793,657 (GRCm39) missense possibly damaging 0.68
R5991:Fsip2 UTSW 2 82,820,812 (GRCm39) missense probably benign 0.28
R6019:Fsip2 UTSW 2 82,818,283 (GRCm39) missense possibly damaging 0.52
R6020:Fsip2 UTSW 2 82,822,471 (GRCm39) missense probably damaging 0.99
R6056:Fsip2 UTSW 2 82,816,017 (GRCm39) missense probably benign 0.01
R6057:Fsip2 UTSW 2 82,809,777 (GRCm39) missense probably damaging 0.99
R6139:Fsip2 UTSW 2 82,821,388 (GRCm39) missense possibly damaging 0.85
R6145:Fsip2 UTSW 2 82,824,112 (GRCm39) missense possibly damaging 0.71
R6160:Fsip2 UTSW 2 82,818,289 (GRCm39) nonsense probably null
R6161:Fsip2 UTSW 2 82,817,601 (GRCm39) missense possibly damaging 0.80
R6166:Fsip2 UTSW 2 82,811,071 (GRCm39) missense probably benign 0.00
R6187:Fsip2 UTSW 2 82,812,798 (GRCm39) missense probably benign 0.33
R6196:Fsip2 UTSW 2 82,820,227 (GRCm39) missense possibly damaging 0.71
R6217:Fsip2 UTSW 2 82,818,762 (GRCm39) missense possibly damaging 0.93
R6276:Fsip2 UTSW 2 82,810,785 (GRCm39) missense possibly damaging 0.91
R6278:Fsip2 UTSW 2 82,819,242 (GRCm39) missense probably benign 0.16
R6349:Fsip2 UTSW 2 82,823,416 (GRCm39) missense probably benign 0.05
R6351:Fsip2 UTSW 2 82,823,028 (GRCm39) missense possibly damaging 0.51
R6401:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6404:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6405:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6437:Fsip2 UTSW 2 82,813,836 (GRCm39) missense possibly damaging 0.73
R6478:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6479:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6480:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6481:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6521:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6529:Fsip2 UTSW 2 82,812,657 (GRCm39) missense probably benign
R6621:Fsip2 UTSW 2 82,820,158 (GRCm39) missense possibly damaging 0.93
R6639:Fsip2 UTSW 2 82,813,571 (GRCm39) missense possibly damaging 0.85
R6649:Fsip2 UTSW 2 82,798,161 (GRCm39) missense possibly damaging 0.83
R6714:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6714:Fsip2 UTSW 2 82,809,878 (GRCm39) missense probably benign 0.01
R6749:Fsip2 UTSW 2 82,808,738 (GRCm39) missense possibly damaging 0.85
R6765:Fsip2 UTSW 2 82,816,776 (GRCm39) missense probably benign
R6790:Fsip2 UTSW 2 82,821,283 (GRCm39) missense possibly damaging 0.53
R6793:Fsip2 UTSW 2 82,819,838 (GRCm39) missense probably benign 0.43
R6795:Fsip2 UTSW 2 82,811,303 (GRCm39) missense probably benign 0.08
R6818:Fsip2 UTSW 2 82,815,544 (GRCm39) missense probably benign 0.04
R6844:Fsip2 UTSW 2 82,813,969 (GRCm39) missense possibly damaging 0.72
R6848:Fsip2 UTSW 2 82,813,131 (GRCm39) missense probably benign 0.26
R6945:Fsip2 UTSW 2 82,823,184 (GRCm39) missense probably benign 0.16
R6950:Fsip2 UTSW 2 82,816,332 (GRCm39) missense probably benign 0.03
R6951:Fsip2 UTSW 2 82,812,293 (GRCm39) missense possibly damaging 0.68
R6974:Fsip2 UTSW 2 82,809,061 (GRCm39) missense probably damaging 0.96
R6987:Fsip2 UTSW 2 82,778,630 (GRCm39) nonsense probably null
R6989:Fsip2 UTSW 2 82,807,298 (GRCm39) missense probably benign 0.00
R7001:Fsip2 UTSW 2 82,817,269 (GRCm39) missense probably damaging 1.00
R7002:Fsip2 UTSW 2 82,819,687 (GRCm39) missense possibly damaging 0.86
R7016:Fsip2 UTSW 2 82,820,979 (GRCm39) missense probably benign 0.25
R7066:Fsip2 UTSW 2 82,821,235 (GRCm39) missense possibly damaging 0.86
R7067:Fsip2 UTSW 2 82,811,078 (GRCm39) missense possibly damaging 0.85
R7077:Fsip2 UTSW 2 82,813,496 (GRCm39) missense probably benign 0.18
R7099:Fsip2 UTSW 2 82,817,968 (GRCm39) missense probably benign
R7126:Fsip2 UTSW 2 82,813,485 (GRCm39) missense possibly damaging 0.53
R7156:Fsip2 UTSW 2 82,813,085 (GRCm39) missense probably benign 0.00
R7165:Fsip2 UTSW 2 82,811,541 (GRCm39) missense possibly damaging 0.77
R7171:Fsip2 UTSW 2 82,816,571 (GRCm39) nonsense probably null
R7189:Fsip2 UTSW 2 82,823,581 (GRCm39) missense possibly damaging 0.92
R7217:Fsip2 UTSW 2 82,819,412 (GRCm39) missense possibly damaging 0.85
R7222:Fsip2 UTSW 2 82,814,015 (GRCm39) missense probably benign
R7228:Fsip2 UTSW 2 82,822,651 (GRCm39) missense possibly damaging 0.93
R7238:Fsip2 UTSW 2 82,812,484 (GRCm39) missense possibly damaging 0.72
R7244:Fsip2 UTSW 2 82,823,607 (GRCm39) missense possibly damaging 0.92
R7251:Fsip2 UTSW 2 82,809,425 (GRCm39) missense possibly damaging 0.95
R7259:Fsip2 UTSW 2 82,812,474 (GRCm39) missense possibly damaging 0.85
R7291:Fsip2 UTSW 2 82,810,863 (GRCm39) missense possibly damaging 0.91
R7316:Fsip2 UTSW 2 82,820,035 (GRCm39) missense possibly damaging 0.93
R7323:Fsip2 UTSW 2 82,819,860 (GRCm39) missense probably benign 0.07
R7335:Fsip2 UTSW 2 82,813,462 (GRCm39) missense probably benign
R7343:Fsip2 UTSW 2 82,809,711 (GRCm39) missense probably benign 0.07
R7346:Fsip2 UTSW 2 82,828,524 (GRCm39) missense probably benign 0.00
R7389:Fsip2 UTSW 2 82,819,140 (GRCm39) missense possibly damaging 0.51
R7391:Fsip2 UTSW 2 82,820,663 (GRCm39) missense possibly damaging 0.70
R7397:Fsip2 UTSW 2 82,815,601 (GRCm39) missense possibly damaging 0.53
R7426:Fsip2 UTSW 2 82,810,441 (GRCm39) missense probably damaging 0.98
R7450:Fsip2 UTSW 2 82,782,024 (GRCm39) missense probably benign 0.30
R7538:Fsip2 UTSW 2 82,818,894 (GRCm39) missense possibly damaging 0.86
R7542:Fsip2 UTSW 2 82,815,196 (GRCm39) missense possibly damaging 0.96
R7549:Fsip2 UTSW 2 82,824,337 (GRCm39) missense probably damaging 0.99
R7564:Fsip2 UTSW 2 82,819,361 (GRCm39) missense probably benign 0.02
R7565:Fsip2 UTSW 2 82,779,856 (GRCm39) missense probably damaging 0.97
R7583:Fsip2 UTSW 2 82,805,585 (GRCm39) missense probably benign 0.12
R7641:Fsip2 UTSW 2 82,817,256 (GRCm39) nonsense probably null
R7655:Fsip2 UTSW 2 82,807,886 (GRCm39) missense possibly damaging 0.91
R7656:Fsip2 UTSW 2 82,807,886 (GRCm39) missense possibly damaging 0.91
R7665:Fsip2 UTSW 2 82,812,149 (GRCm39) missense probably benign 0.03
R7672:Fsip2 UTSW 2 82,820,455 (GRCm39) missense possibly damaging 0.93
R7764:Fsip2 UTSW 2 82,811,252 (GRCm39) missense possibly damaging 0.93
R7790:Fsip2 UTSW 2 82,818,723 (GRCm39) missense probably benign
R7811:Fsip2 UTSW 2 82,828,797 (GRCm39) missense possibly damaging 0.93
R7838:Fsip2 UTSW 2 82,807,044 (GRCm39) missense probably benign 0.00
R7873:Fsip2 UTSW 2 82,779,856 (GRCm39) missense probably damaging 0.97
R7902:Fsip2 UTSW 2 82,808,168 (GRCm39) missense possibly damaging 0.72
R7920:Fsip2 UTSW 2 82,781,365 (GRCm39) missense possibly damaging 0.94
R7959:Fsip2 UTSW 2 82,816,120 (GRCm39) missense possibly damaging 0.51
R8009:Fsip2 UTSW 2 82,818,793 (GRCm39) missense possibly damaging 0.85
R8031:Fsip2 UTSW 2 82,817,235 (GRCm39) missense probably benign
R8034:Fsip2 UTSW 2 82,819,699 (GRCm39) missense possibly damaging 0.92
R8037:Fsip2 UTSW 2 82,816,322 (GRCm39) missense possibly damaging 0.72
R8110:Fsip2 UTSW 2 82,789,017 (GRCm39) missense probably benign 0.00
R8117:Fsip2 UTSW 2 82,823,296 (GRCm39) missense possibly damaging 0.86
R8138:Fsip2 UTSW 2 82,806,141 (GRCm39) missense possibly damaging 0.83
R8175:Fsip2 UTSW 2 82,818,021 (GRCm39) missense probably benign 0.16
R8175:Fsip2 UTSW 2 82,815,088 (GRCm39) missense probably benign 0.06
R8182:Fsip2 UTSW 2 82,806,951 (GRCm39) missense probably damaging 0.99
R8206:Fsip2 UTSW 2 82,820,808 (GRCm39) missense possibly damaging 0.85
R8229:Fsip2 UTSW 2 82,808,487 (GRCm39) missense possibly damaging 0.63
R8239:Fsip2 UTSW 2 82,819,687 (GRCm39) missense possibly damaging 0.71
R8245:Fsip2 UTSW 2 82,811,346 (GRCm39) missense possibly damaging 0.79
R8303:Fsip2 UTSW 2 82,818,724 (GRCm39) missense probably benign 0.00
R8336:Fsip2 UTSW 2 82,821,099 (GRCm39) missense possibly damaging 0.53
R8347:Fsip2 UTSW 2 82,818,198 (GRCm39) missense probably benign 0.16
R8351:Fsip2 UTSW 2 82,822,239 (GRCm39) missense possibly damaging 0.73
R8352:Fsip2 UTSW 2 82,814,937 (GRCm39) missense probably benign
R8419:Fsip2 UTSW 2 82,808,963 (GRCm39) missense probably damaging 0.96
R8431:Fsip2 UTSW 2 82,811,910 (GRCm39) missense probably damaging 1.00
R8439:Fsip2 UTSW 2 82,807,430 (GRCm39) missense probably benign 0.24
R8452:Fsip2 UTSW 2 82,814,937 (GRCm39) missense probably benign
R8459:Fsip2 UTSW 2 82,810,022 (GRCm39) missense possibly damaging 0.95
R8465:Fsip2 UTSW 2 82,810,284 (GRCm39) missense probably benign 0.26
R8473:Fsip2 UTSW 2 82,777,336 (GRCm39) missense probably damaging 0.99
R8703:Fsip2 UTSW 2 82,821,871 (GRCm39) missense probably damaging 0.98
R8711:Fsip2 UTSW 2 82,815,246 (GRCm39) missense possibly damaging 0.53
R8713:Fsip2 UTSW 2 82,811,453 (GRCm39) missense probably damaging 1.00
R8789:Fsip2 UTSW 2 82,815,822 (GRCm39) missense possibly damaging 0.73
R8805:Fsip2 UTSW 2 82,813,453 (GRCm39) missense possibly damaging 0.46
R8840:Fsip2 UTSW 2 82,821,606 (GRCm39) missense probably benign 0.03
R8855:Fsip2 UTSW 2 82,810,521 (GRCm39) missense probably benign 0.04
R8866:Fsip2 UTSW 2 82,810,521 (GRCm39) missense probably benign 0.04
R8875:Fsip2 UTSW 2 82,820,782 (GRCm39) missense possibly damaging 0.95
R8883:Fsip2 UTSW 2 82,809,524 (GRCm39) missense possibly damaging 0.68
R8903:Fsip2 UTSW 2 82,807,681 (GRCm39) missense possibly damaging 0.83
R8907:Fsip2 UTSW 2 82,816,984 (GRCm39) missense probably benign 0.20
R8912:Fsip2 UTSW 2 82,810,938 (GRCm39) missense probably benign
R8926:Fsip2 UTSW 2 82,823,927 (GRCm39) missense possibly damaging 0.84
R8991:Fsip2 UTSW 2 82,815,370 (GRCm39) missense probably benign 0.33
R9014:Fsip2 UTSW 2 82,806,898 (GRCm39) missense probably benign 0.32
R9014:Fsip2 UTSW 2 82,817,075 (GRCm39) missense possibly damaging 0.71
R9039:Fsip2 UTSW 2 82,828,545 (GRCm39) missense probably benign 0.32
R9054:Fsip2 UTSW 2 82,806,180 (GRCm39) missense possibly damaging 0.68
R9114:Fsip2 UTSW 2 82,807,301 (GRCm39) missense probably benign 0.00
R9124:Fsip2 UTSW 2 82,816,103 (GRCm39) missense probably benign 0.00
R9131:Fsip2 UTSW 2 82,813,170 (GRCm39) missense probably benign
R9149:Fsip2 UTSW 2 82,812,374 (GRCm39) missense possibly damaging 0.86
R9180:Fsip2 UTSW 2 82,815,574 (GRCm39) missense possibly damaging 0.96
R9192:Fsip2 UTSW 2 82,817,844 (GRCm39) missense probably benign 0.06
R9216:Fsip2 UTSW 2 82,820,425 (GRCm39) missense probably damaging 0.99
R9218:Fsip2 UTSW 2 82,823,062 (GRCm39) missense probably damaging 0.97
R9222:Fsip2 UTSW 2 82,815,958 (GRCm39) missense probably benign 0.00
R9262:Fsip2 UTSW 2 82,807,662 (GRCm39) missense probably benign 0.00
R9340:Fsip2 UTSW 2 82,818,604 (GRCm39) missense possibly damaging 0.71
R9342:Fsip2 UTSW 2 82,818,747 (GRCm39) missense possibly damaging 0.71
R9368:Fsip2 UTSW 2 82,811,039 (GRCm39) missense possibly damaging 0.68
R9372:Fsip2 UTSW 2 82,822,756 (GRCm39) missense possibly damaging 0.71
R9385:Fsip2 UTSW 2 82,819,793 (GRCm39) missense possibly damaging 0.84
R9432:Fsip2 UTSW 2 82,805,907 (GRCm39) missense probably damaging 0.98
R9434:Fsip2 UTSW 2 82,816,702 (GRCm39) missense possibly damaging 0.71
R9445:Fsip2 UTSW 2 82,806,132 (GRCm39) missense probably damaging 0.99
R9472:Fsip2 UTSW 2 82,817,285 (GRCm39) missense possibly damaging 0.85
R9496:Fsip2 UTSW 2 82,793,062 (GRCm39) missense probably benign
R9523:Fsip2 UTSW 2 82,807,972 (GRCm39) missense probably damaging 0.99
R9567:Fsip2 UTSW 2 82,798,173 (GRCm39) missense probably benign
R9636:Fsip2 UTSW 2 82,820,563 (GRCm39) missense possibly damaging 0.52
R9643:Fsip2 UTSW 2 82,821,984 (GRCm39) missense possibly damaging 0.53
R9680:Fsip2 UTSW 2 82,819,272 (GRCm39) missense probably benign 0.32
R9695:Fsip2 UTSW 2 82,806,226 (GRCm39) missense probably benign
R9705:Fsip2 UTSW 2 82,823,634 (GRCm39) missense probably benign
R9739:Fsip2 UTSW 2 82,823,896 (GRCm39) missense possibly damaging 0.71
R9751:Fsip2 UTSW 2 82,818,241 (GRCm39) missense probably benign 0.00
R9761:Fsip2 UTSW 2 82,821,994 (GRCm39) missense probably benign 0.00
R9798:Fsip2 UTSW 2 82,810,225 (GRCm39) nonsense probably null
RF003:Fsip2 UTSW 2 82,821,865 (GRCm39) missense probably benign 0.02
RF005:Fsip2 UTSW 2 82,822,876 (GRCm39) missense probably benign 0.04
RF008:Fsip2 UTSW 2 82,808,184 (GRCm39) missense probably benign
RF028:Fsip2 UTSW 2 82,824,352 (GRCm39) frame shift probably null
RF029:Fsip2 UTSW 2 82,824,352 (GRCm39) frame shift probably null
RF036:Fsip2 UTSW 2 82,814,707 (GRCm39) critical splice acceptor site probably benign
RF038:Fsip2 UTSW 2 82,824,352 (GRCm39) frame shift probably null
RF062:Fsip2 UTSW 2 82,814,707 (GRCm39) critical splice acceptor site probably benign
X0018:Fsip2 UTSW 2 82,812,851 (GRCm39) nonsense probably null
X0020:Fsip2 UTSW 2 82,781,364 (GRCm39) missense probably damaging 1.00
X0025:Fsip2 UTSW 2 82,785,290 (GRCm39) missense possibly damaging 0.70
X0027:Fsip2 UTSW 2 82,807,122 (GRCm39) missense probably benign 0.35
X0066:Fsip2 UTSW 2 82,817,807 (GRCm39) missense possibly damaging 0.51
Z1088:Fsip2 UTSW 2 82,818,978 (GRCm39) missense possibly damaging 0.85
Z1088:Fsip2 UTSW 2 82,817,997 (GRCm39) missense possibly damaging 0.86
Z1088:Fsip2 UTSW 2 82,805,792 (GRCm39) missense probably damaging 0.96
Z1176:Fsip2 UTSW 2 82,820,009 (GRCm39) missense probably benign 0.02
Z1177:Fsip2 UTSW 2 82,814,868 (GRCm39) missense probably damaging 0.98
Z1177:Fsip2 UTSW 2 82,777,304 (GRCm39) missense probably damaging 0.99
Z1177:Fsip2 UTSW 2 82,817,547 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGGCAGACCAAGTATCTATGAGCCC -3'
(R):5'- TGCCTGACACACTCCCTTGTGAAC -3'

Sequencing Primer
(F):5'- TGGACAGAATACACTCTTACAGG -3'
(R):5'- ACACTCCCTTGTGAACTCCTC -3'
Posted On 2014-04-24