Incidental Mutation 'R1590:Itga10'
ID177790
Institutional Source Beutler Lab
Gene Symbol Itga10
Ensembl Gene ENSMUSG00000090210
Gene Nameintegrin, alpha 10
Synonyms
MMRRC Submission 039627-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R1590 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96645584-96664519 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 96651738 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]
Predicted Effect probably benign
Transcript: ENSMUST00000029744
SMART Domains Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1123 1145 N/A INTRINSIC
low complexity region 1153 1166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119365
SMART Domains Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1122 1144 N/A INTRINSIC
low complexity region 1152 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137564
SMART Domains Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

DomainStartEndE-ValueType
Pfam:PEX11 1 172 4.5e-57 PFAM
low complexity region 186 204 N/A INTRINSIC
Int_alpha 222 278 9.03e-3 SMART
Blast:VWA 292 345 3e-7 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.4%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A T 8: 84,167,086 Q294L probably benign Het
Aamp A G 1: 74,283,211 S95P probably damaging Het
Ankmy1 T C 1: 92,888,675 Y239C probably damaging Het
Atp12a T C 14: 56,380,055 S601P probably damaging Het
Atp1b3 T C 9: 96,343,349 T89A probably benign Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Btnl2 A T 17: 34,361,140 I216F possibly damaging Het
Cabs1 A T 5: 87,979,631 H47L probably damaging Het
Ccdc68 T A 18: 69,940,180 D66E probably benign Het
Cdc42ep4 T C 11: 113,728,566 D333G possibly damaging Het
Ckmt1 G A 2: 121,363,522 D389N possibly damaging Het
Dact1 G T 12: 71,317,575 V340F probably benign Het
Dnah2 A G 11: 69,422,754 probably null Het
Dnah2 T C 11: 69,521,198 T246A probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Efcab14 A G 4: 115,756,549 probably benign Het
Eprs A G 1: 185,401,510 T795A probably damaging Het
Esp36 T A 17: 38,417,311 E26D possibly damaging Het
Fpr-rs7 T C 17: 20,113,416 T271A probably benign Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gimap7 G A 6: 48,724,019 V180M probably damaging Het
Gm6614 C T 6: 141,980,872 S576N probably benign Het
Gtf3c1 T C 7: 125,676,661 H531R possibly damaging Het
Herc1 T A 9: 66,491,953 probably benign Het
Hip1r A G 5: 124,002,140 Y1061C probably benign Het
Ipo11 T C 13: 106,886,717 Y420C probably damaging Het
Ipo8 T C 6: 148,810,665 probably null Het
Klhl1 A T 14: 96,368,636 M243K probably damaging Het
Lrp2 A G 2: 69,466,763 probably null Het
Mag T C 7: 30,901,852 E439G probably damaging Het
Mcm3ap T A 10: 76,496,541 F1231I probably benign Het
Mcmdc2 C T 1: 9,916,555 Q204* probably null Het
Mpl A C 4: 118,444,024 L548R probably damaging Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Myo18b G A 5: 112,875,266 Q87* probably null Het
Nfat5 A G 8: 107,293,890 Y22C probably damaging Het
Nnt T A 13: 119,386,661 I232L possibly damaging Het
Olfr12 G A 1: 92,620,745 V280M possibly damaging Het
Olfr146 T C 9: 39,018,957 N195D probably benign Het
Olfr437 A G 6: 43,167,912 N285D probably damaging Het
Parp2 C T 14: 50,810,544 P76S probably benign Het
Pick1 C T 15: 79,245,301 H169Y probably benign Het
Prtg T A 9: 72,842,807 F164L probably benign Het
Pygb A G 2: 150,817,663 D422G possibly damaging Het
Samd9l C A 6: 3,375,761 C500F probably benign Het
Sbno1 A C 5: 124,384,504 N1083K possibly damaging Het
Sept7 C T 9: 25,277,604 S77F probably damaging Het
Slc25a44 A G 3: 88,416,007 V264A possibly damaging Het
Slf2 G T 19: 44,942,073 E530* probably null Het
Svs2 A G 2: 164,237,658 S110P possibly damaging Het
Tmbim7 G T 5: 3,665,338 probably null Het
Tpgs2 T C 18: 25,140,573 D177G probably damaging Het
Uba1y T A Y: 826,893 F516L probably damaging Het
Ulk1 A G 5: 110,795,766 V211A probably damaging Het
Vmn1r237 T A 17: 21,314,039 I8N probably damaging Het
Vmn2r103 G T 17: 19,794,234 M429I probably benign Het
Vmn2r112 T C 17: 22,615,008 probably null Het
Vmn2r84 T C 10: 130,391,480 probably null Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Other mutations in Itga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Itga10 APN 3 96647641 missense probably damaging 0.96
IGL01694:Itga10 APN 3 96652517 missense probably damaging 0.99
IGL01754:Itga10 APN 3 96656775 unclassified probably benign
IGL02527:Itga10 APN 3 96655624 unclassified probably benign
IGL02956:Itga10 APN 3 96655113 missense possibly damaging 0.46
IGL03371:Itga10 APN 3 96654788 missense possibly damaging 0.84
IGL03055:Itga10 UTSW 3 96650520 missense probably damaging 0.99
PIT4515001:Itga10 UTSW 3 96662632 missense probably damaging 0.99
R0153:Itga10 UTSW 3 96653700 missense probably benign 0.00
R0308:Itga10 UTSW 3 96651464 missense probably damaging 1.00
R0331:Itga10 UTSW 3 96652483 missense probably damaging 1.00
R0413:Itga10 UTSW 3 96649059 missense probably damaging 1.00
R0437:Itga10 UTSW 3 96649137 missense probably damaging 1.00
R0511:Itga10 UTSW 3 96658174 missense probably damaging 1.00
R0630:Itga10 UTSW 3 96656299 unclassified probably benign
R0844:Itga10 UTSW 3 96651738 splice site probably benign
R0849:Itga10 UTSW 3 96652530 missense possibly damaging 0.67
R0894:Itga10 UTSW 3 96653660 missense possibly damaging 0.69
R0919:Itga10 UTSW 3 96651738 splice site probably benign
R1027:Itga10 UTSW 3 96651738 splice site probably benign
R1341:Itga10 UTSW 3 96652495 missense probably damaging 1.00
R1350:Itga10 UTSW 3 96657477 missense probably benign 0.01
R1370:Itga10 UTSW 3 96651738 splice site probably benign
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1589:Itga10 UTSW 3 96651738 splice site probably benign
R1601:Itga10 UTSW 3 96653658 missense possibly damaging 0.82
R1659:Itga10 UTSW 3 96662977 missense probably damaging 0.96
R1665:Itga10 UTSW 3 96651738 splice site probably benign
R1667:Itga10 UTSW 3 96651738 splice site probably benign
R1686:Itga10 UTSW 3 96651825 missense probably damaging 0.97
R1972:Itga10 UTSW 3 96651738 splice site probably benign
R1976:Itga10 UTSW 3 96651738 splice site probably benign
R2020:Itga10 UTSW 3 96652490 missense probably damaging 1.00
R2040:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96657690 missense probably benign
R2045:Itga10 UTSW 3 96651738 splice site probably benign
R2060:Itga10 UTSW 3 96654998 nonsense probably null
R2146:Itga10 UTSW 3 96651492 missense possibly damaging 0.59
R2146:Itga10 UTSW 3 96653723 missense probably damaging 1.00
R2170:Itga10 UTSW 3 96650457 missense probably damaging 1.00
R2893:Itga10 UTSW 3 96655100 missense probably benign 0.11
R2926:Itga10 UTSW 3 96652849 missense probably damaging 1.00
R3622:Itga10 UTSW 3 96651738 splice site probably benign
R3623:Itga10 UTSW 3 96651738 splice site probably benign
R4416:Itga10 UTSW 3 96658246 missense possibly damaging 0.58
R4633:Itga10 UTSW 3 96647704 missense possibly damaging 0.92
R5074:Itga10 UTSW 3 96652211 nonsense probably null
R5095:Itga10 UTSW 3 96648164 missense probably benign 0.21
R5495:Itga10 UTSW 3 96647371 missense possibly damaging 0.92
R5813:Itga10 UTSW 3 96652585 missense probably benign 0.38
R6114:Itga10 UTSW 3 96649035 missense probably damaging 1.00
R6172:Itga10 UTSW 3 96647437 missense probably benign 0.18
R6275:Itga10 UTSW 3 96658185 missense probably benign 0.36
R6298:Itga10 UTSW 3 96656762 missense probably benign 0.00
R6433:Itga10 UTSW 3 96658041 critical splice donor site probably null
R6841:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R6909:Itga10 UTSW 3 96662599 missense probably benign 0.00
R6927:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R7124:Itga10 UTSW 3 96651765 missense probably damaging 0.96
R7310:Itga10 UTSW 3 96648159 missense probably damaging 1.00
R7387:Itga10 UTSW 3 96652778 missense probably benign 0.11
R7464:Itga10 UTSW 3 96648155 missense probably damaging 1.00
R7624:Itga10 UTSW 3 96652953 missense probably benign
R7638:Itga10 UTSW 3 96657391 splice site probably null
R7639:Itga10 UTSW 3 96649582 missense probably benign 0.36
R7893:Itga10 UTSW 3 96649612 missense probably damaging 1.00
R8297:Itga10 UTSW 3 96654800 missense probably damaging 1.00
X0064:Itga10 UTSW 3 96652936 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGGATAGACCCTGACCCTCTCAAC -3'
(R):5'- GGTTTCCTGAAGGCATAAGGCGAG -3'

Sequencing Primer
(F):5'- ATAAGCCCCCTACTTCTAATTCAG -3'
(R):5'- CTAAGGGGGAGTGCCTCATAC -3'
Posted On2014-04-24